F's

Please don't go away.

2010-09-23T21:15:00.003+08:00

HAPPY BIRTHDAY KEY! ♥

Heh, still remembered the time when I went to the Changi Airport and The Singapore Entertainment Awards just to see SHINee, and especially you. :) But I won't do all these anymore. :)

Watched the American Idol just now, bikini boy woots (Y)

2NE1's Go Away and FT Island's Love Love Love are currently my addictions. Can't get enough of them. I'm still into Kpop, uh-oh.

This brilliant idea.

2010-09-16T00:50:00.002+08:00

I, don't, feel, like, blogging, anymore.
Set.

Twitter is your alternative of keeping in contact with me. :)
Twitter, yay.
Byez.

Alternatives?

2010-08-10T18:17:00.003+08:00

If only you're able to see this, Dad, because you're not the only sole winner in this world. It's not as if you're the most authoritative person, it's not as if you own anyone, because you came to this world empty-handed and should leave with nothing too. You don't own Mom, you just own her heart. However, that doesn't give you any rights to scold her anything that comes out from your mind instantly, not to say vulgarities. If you dislike her, why would you marry her in the first place? I know, I'm in the wrong to shout at you in the public. If you've the brain to think of your face and pride then I don't see why you don't have the rightful mindset to think for Mom too? You're right to reprimand me, but do you think you have any stand in scolding Uncle? You want face, but you think others don't want it too? You say I just side with Mom everytime, but do you even know the reason behind it? You always think that you're the right one, and the rest are always the wrong ones, because you don't even give others a chance to explain! You say I don't give you a chance to explain, because you don't even bother to talk to me! Then why the hell you want to explain now? You're angry for a week? Come on, you're goddamn emotionless, how the hell am I supposed to interpret you? I've reflected, I tried to talk to you, you refused to talk to me. Fine, at least I've tried my best. I'm just gonna fuck care everything now. You want to be the greatest? You shall be then.

I don't see why you can't be like other people's dads, that's always approachable while you're always sitting at home whining about how unfair life is. You've wonderful wife and children, it's just that you don't know how to appreciate them. I'm not disappointed in you, I'm just speechless by your childish behaviour.

I'm sorry for the abuse of the vulgarities, I've tried to cut them down already.
And another rant, again.
And please, I don't wish to have any regards now. I just want to have a peace of mind. Sorry & thanks.

Who can tell me what I should do now?
Kinship is in a mess, studies is a screwed up.
I'm feeling helpless suddenly.

What if.

2010-07-29T19:09:00.003+08:00

There are so many things to rant about, sigh~

I've tried to be a better person for the past 2 days, seems like people are taking advantage of me. Seems like it's not that good to be a good person, but at least I tried. And I'm learning to be a better person. But why does it seem to be so difficult? Why do I always encounter friendship problem? Is there something wrong with my character or personalities? When I said I'm fine with people who ignore me, and I'm used to it, I'm not. To be honest, I'm not okay with it. I'm not an attention-seeker but I do want people to pay some attention to me. I wonder how (you) feel for the past 3 months, it must be a torture for you. Next, I wanted to be more tolerance, but I can't. Some jokes are really mean, though I know they're jokes. Some jokes are offensive, though I know they're jokes. You can call me petty or what, but they're really very mean and offensive. Try be in my shoes and feel it. You won't like it, I swear. In fact, nobody likes it. And I finally know how (you) feel, I'm sorry. Next, humans are selfish by nature. But I don't get it, (he) doesn't act like the way (you) do, even though both of you achieved almost the same results. And (he)'s the one that I've bad impression with. It's useless if you're good at everything but lack of a good personalities and character.

Finally, I still love my life even though I know the current path that I'm taking is tough. I can never go back to the time when I've to decide whether I'm going to TP or RP. It's the past that made me to who I am now, and I can't go back anymore. Nevertheless, I've friends that always by my side and I'll treat them like my family.

Studies is my priority now so I won't think of all this for the time being.

Yes or not?

2010-07-13T21:05:00.002+08:00

To my beautiful you,
Yes it's you my dear winkwink* ;) Just wanna say a very big THANK YOU to you. Thanks for the blessings. I believe everything will work out pretty well. :) You'll find your Happiness very soon, just have faith in yourself alright. If he don't come out, have the courage and initiative to bring him out. Don't miss the chance. :) And my dear, please don't be angry with bitches. They don't deserve you wasting your energy over them. You can save them up and use them for other purposes. :) Keep cool always, alright? :)

Let's meet up soon because...
I LOVE YOU AND I MISS YOU A LOT.

This post is dedicated to the only you. :)
This time round, I found Happiness.

2010-07-04T13:00:00.002+08:00

I'm trying to divert all my attention to other things.

I'm trying to.

And still trying.

But I can't.
Why?

Irreplaceable heart.

2010-06-27T16:03:00.003+08:00

Miss me? :)

Eenie meenie miney mo.

2010-06-22T01:52:00.002+08:00

A missing heart is a loving heart.

Hihihihihi people! :D

School has just started, again. The feeling of being in a holiday will soon fade away, and the serious mood will have to come back again. Sigh, stress is catching up with me soon. :( But nvm, I've pillar of strength around me, thanks a lot. ♥

Next update then. :)

I want you here forever by my side. :)

I will never let you go.

2010-06-13T00:20:00.002+08:00

This week is mega-packed! Fannie is a busy girl, and me like! (Y)

Had been going out everyday, spent like around 150 bucks this week. Mom's gonna kill me lol. Movies all the way - Killers, Prince Of Persia, A-Team & Karate Kid. Wanted to watch A Nightmare At The Elm Street one but then sold out. :( Mouth-watery food too - Pastamania, Ajisen, Flying Chilli, KFC, Burger King, Xin Wang Hong Kong Restaurant & Starbucks. Man I'm going to get fatter and fatter if this continues on. :( Flying Chilli wasn't that bad, just that the food was a bit disappointed because the food wasn't that spicy enough. T.G.I Friday whatever shit restaurant in Heeren was a total shit. Went there to drink and the staff questioned us of our age. Hehe okay I'm not yet eighteen! Whatever. The Mon... was nice, peppermint! ^^ And I swear I'll never go into Heeren again, rawr!

Lazy to post pictures up but you can find them at Facebook. :)

Next update then. :)
I'm missing everyone now.
Especially you. ♥

Locked heart.

2010-06-02T22:40:00.000+08:00

Owned the world since 1993.

Nothing is gonna be the same anymore.

2010-05-22T01:23:00.003+08:00

2009: Sha'abaniah, Edwin Wee, Pei Shi, Ya Ling, & Vanessa Butt.
2010: Daniaal, Mike, Guan Guan & Joey.

Thanks for being there for me always, even times when I'm not that strong. You people are my pillar of strength, boost my mood up whenever I'm down. I just want you all to know that I'm missing you people (2009) and loving you people (2010) and always will (2009 & 2010). You know why rainbow has seven colours? Because you guys fill it up. Thank you, the colours of my life. ♥

Thanks Jeralyn for always being such a bimbotic sister, always bitching about bitches with me, cracking up all the jokes and laugh with me. You're one of the rarest bimbo that I love. :)

Thanks JoJo for always accompanying me to dine at Express Tep-panyaki, but next time let's go to other places yeah? I'm quite tired of eating it already haha.

This is a dedication to you guys, not mushy okay! These are my heartfelt words. :)
Thanks, my love ones. ♥

Still as ever.

2010-05-02T00:11:00.004+08:00

Love the expression of his when the banana fell off, the way he eats the remaining of the banana.
Cutie pie. ♥

Back to basic, life is good, so far so good. Class isn't that bonded anymore, people tend to part their ways after lectures/ tutorials. Sometimes I just wished that there's another round of Week 0 orientation, so that the whole class can participate together because by this time we've know each other quite well already, right Dan? Winkwink* ;)

Anyway, I think I sucked in every subject except for EM1. Gosh, I don't understand a single shit out of it so far. And it's been the second week already! And I hate it when the whole class is studying and I'm the only one who is slacking around. Sometimes, I just hate the atmosphere of being around with them. I don't want to get stressed around, I just want to have time to study and play evenly. Gah, I'm not making any sense here.

Should go and study now. Yes I know it's 12:23am already. I'm mad don't ya'know? :)

Next update then. :)

When you can't carry on,

2010-04-24T23:46:00.002+08:00

Been feeling super ill for the past 6 days. And tomorrow's gonna be a week already. Damn, my cough had never been that bad at all. Feel like the bottom of the pit now. Sorry guys if I've passed my sickness to you. I'll bring super nice stuffs on Monday. I wanna recover sooooooooooooon. :)

1st week of the school ended not that bad. Basically, just met up with my classmates everyday before heading to LTs. Love it! Just realised how much I've changed since this year. Those who knows me, you know I'm not like that last year right? Been a quiet and always-keep-to-self girl to a hyper and crazy and open-minded (lol Andy Ling Yuan and Guan Guan) girl. Lol. Hope I'll continue to stay in this way and not going to change anymore. Poly life is a new start for me and I swear I'll end it in a nice way too. :)

D1 D1, wanna make friend with you~ :P

Next update then. :)

It doesn't matter.

2010-04-20T19:51:00.002+08:00

Daniaal's words struck me. It's like, I couldn't understand myself that better but he could totally understand me. Is it because he's a player? Hehe joking hor ah beng! Don't come find me with chopper ah! :P

Was super sick today, totally don't feel like going to school okay! 38.9 degrees, after that became 38.3 degrees. Shucks, should I go school tomorrow?

And shit man, I can't get you out of my head!
Lhk lhk lhk. ♥

Next update then. :)

Lost sensation.

2010-04-17T02:31:00.001+08:00

I never understood what I wanted.
And now I know.

A10D3. ♥

2010-04-15T20:53:00.003+08:00

A10D3. Best class ever since 4D'09. Met lotsa wonderful friends. Of course, initiated to approach to people too. I guess I'm changing now. :) There are friends who are super familiar to me, like I've seened them somewhere before, but I'm just a stranger to them. But it's okay, we'll get along pretty soon. :) My class has only got 5 girls, including me. Pretty sad. Last year, I wished my class has more boys. This year, I wished we've more girls. :(

Orientation from Monday. Don't want to elaborate because I'll be nagging already. Lol. Overnight amazing race was just simply (Y). OLs Amin and Wai Kit(?) are (Y) too. Tomorrow's the last day, and Monday will be starting school already. My god, that's god damn fast. Like what Andy said, the last time I've counted for my holidays I still have 1 month and now.. :O

A10D3 FTW. ♥
Next update then. :)

Everyone has its(?) limits.

2010-04-09T01:37:00.002+08:00

I'm an emotional kid, this is something that I must admit of. I can get really worked up over a little matter. I can't get over a thing that easily, I tend to think a lot about it, even though it may be over like long ago. I can't control my temper, you can call me a hot-tempered kid. I smile, laugh, frown, cry whenever I feel like it. I tend to hide my feelings and can't seem to express them out easily.

That's the way I am.

You may find me to be very rebellious now but I'm not, I'm just learning how to defend myself. Because in this society, if you don't stand up and defend yourself, who will? Perhaps your parents will, but for how long can they protect you? They can't protect you forever right? That's why we must learn to defend ourselves, and that's the exact thing I'm doing for myself, defend.

For what happened just now, yes I admit that there's parts of my fault. But you can't just push all the blames to me right? It takes two hands to clap. Nothing happens without a reason. Why can't you understand at all after all these things? Why must you sound like it's always my fault, that you're always the right one and I'm always in the wrong? Why can't you think that what is the exact thing that led to this state?

I find that living in this house is simply useless at all. I don't have the family feel anymore. Dad don't seem to like Brother that much, always scold Sister and I. Mom seems to be quite favouritism towards Brother, Sister just being the neutral one, siding no one and keeping in silent even if anyone quarrels. Tell me, does it feel like a family to you? I've this imbecile Brother that sometimes I really feel like disowning him if I've an opportunity to do so. I've this type of parents that I feel like running away from home. I've this type of family that don't have the feeling of family at all. Sometimes I just wonder, am I part of this family, does my Mom really give birth to me or not. It just sucks to feel this way, but I can't help it.

And whenever I'm bothered, I wanted to find someone to confide to but there's no one that could do so. My family, hopeless. Friends, not one. I can't be that selfish enough to just force someone to listen to all my problems without considering their feelings. Afterall, I can't own them. Friends will come and go. They'll find new friends and move on. Only some will still remember you even though they meet new friends.

For now, I really hope that I can find someone to confide in.
Just anyone, please.

Not feeling that good right now. :(

Gone-away happiness.

2010-04-08T03:19:00.005+08:00

What's up! Another update again hohoho. :D

--

1 April - 4 April, Thursday - Sunday.
Been working as an adhor(?) in Isetan. Torture man. Not the work, but the people who were working there. Lazy to elaborate more. Just know that I survived! Lol.

--

5 April, Monday.
Outing with girls, YaLing, Charmaine, Vanessa and HuiJun. Finally! After 2 months *cough.. Vanessa cough..* :P Went to Bugis and for the first time shop the longest in Bugis Street. Like damn long hours okay! Took lotsa pictures but all with Vanessa Vanvanvan. Rawr, faster upload in Fb nuren! Then makan at Just Acia @ Marina Square. Hope we won't kanna blacklisted hehehe *inside joke*. Then home-d.

--

6 April, Tuesday.
Outing with girls again. This time without HuiJun coz she's sick. Get well soon girl! Out to teoheng! :D First time in my 17 years of life going there okay. Like a mountain turtle like that lol. Anyway, went there sang for the full 5 hours, shiokness to the max lah. After that wanted to go eat at Aston's but full of people lo. Then dined at some unknown restaurant. Started the whole blacklisting thing again hahahahahaha can't get enough yo. :) Then home-d.

Pictures of that day,

When are we going out again? Can't wait ahhhhhhhhhh. :)

Feel like buying lotsa things but the thought of it had already made me broke. :( Moni moni faster come, or drop from the sky please. :P

Outta here.
Next update then. :)

Say no.

2010-04-01T23:56:00.004+08:00

Yo yo yo yo yo me come and blog again liao. ^^ Lol.

No pictures today, too badddddddddd. Work's been a bitch. Had been tolerating people's attitude today, fucked up to the max. -'- Especially you! I guess people who know me well will know who that person is. Damn fucked up lah. By you and bloody customers. Almost irritated till wanna cry sia, but I won't shed a tear because of you this type of people. Not worth it okay! Don't understand why there are selfish people living around in this world. If there's no selfish people, how nice this world would be. Sigh, this dirty world that only cares about materialistic people~

Yay went to Express Tepanyaki (again) with JoJo and hella nice, never get enough one okayyyyyyy. Think gonna be there de regular customer lol.

Today went to work, PekHoon saw me and asked who I am. -.- And she told me I got fat liao lol. Yay I think so too. Because..
Go out = Korean Restaurant/ Seoul Garden/ Express Tepanyaki/ Haagen Darz. And yeah is like everytime I go out yo. But most of the outings I'll eat Xpress. :) But look at this!! Not fat then miracle ah! But can't resist the temptation leh. Like, you see this mouth-watering food in front of you don't booshit with me that you'll not get resisted okay. I know you will hahahahahahaha.

Whatever I'm talking nonsense here so I'm out!
P/s: Changed blogsong to Incomplete. Oh Jayyyyyyyyyy, ♥
Next update then. ;)

Addicted.

2010-03-30T01:57:00.004+08:00

Are you looking for me baby?
Hehehe.

Give it to me.

2010-03-28T05:08:00.001+08:00

Hihihihihihi. :)

The time now is: 5:08AM and yeah I'm still awake. Finally I've uploaded all the photos of the happenings for the last few days/weeks, excluding some of my selcas lol. They ate up my sleeping time. :(

Attention: Major selcas up ahead, please quickly scroll down if you do not want to see them. Thanks. Lol.

Here it goes.
--

6 March, Saturday.
Nothing to do so I took a picture of Onew coz I'm watching JoJo live. ^^

Charismatic much. :)

JoJo, don't kill me please. :P

--

8 March, Monday.
Went to Zoo with YaLing, Ivan and Nicholas. Forgot about the details already but I wanna go there again. ^^ Only know that it rained like stupid on that day. -.-

I chua tio-ed when I walked past all these elephants. For once I thought they were real. -.-

Small small don't want to let you see my ugly face hehehe.

Click on the pictures below to see the animals if they look small.

--

10 March, Wednesday.
Sakura-ed with PeiShi, QiuYan, ChenChen and her boyf and SiewLin. Angela came and went off lol. Only one picture, the rest don't know with who. o.o

Hello ChenChen & PeiShi. ^^

--

13 March, Saturday.
Went to Singapore Entertainment Awards @ Marina Bay with JoJo. One reason: SHINee! ♥ And seriously out of the 10000 audiences who went there, 5000++ of them were there just for SHINee. Omg mad crazy and I'm one of them lolololololol but never regret ah. At least I can go feel the atmosphere of how the kshawols feel. Unforgettable memories lol. And sorry ah JoJo, I took soooooooooo long to post the pictures up. You can grab them. ^^

--

19 March, Friday.
Out with Sist, Harry, Shaun, Alvin, GuanHong(?) and JiaHao to eat a Japanese restaurant (don't know what it's english name called) at Downtown East. After that went to White Sands and played arcade. Then home-d.

Err, selcas.

--

26 March, Friday.
Class outing (not) with Sha'abaniah, Cheryl, Edwin and GuoWei. Fun outing though it's supposed to be a class outing. Funny thing happened. Sorry Sha, I felt very bad for not helping you. I feel that I'm a bad friend. Really. Sorry. :( Went from Parkway Parade to Boon Keng coz meeting Cheryl there. Chit chat for awhile more before heading back home.

Psh, my eyes looked freaking small. Whatever.

Boo! Hidden camera hahahaha. Edwin take what photo lah!

Hi Sha'abaniah I miss you!

Sha the obstacle blocking Cheryl. :(

Hello Cheryl minihead. ^^

Squashing Edwin the asshole muahahahahaha. :)

And I swear I'm not going to organise outing anymore. Not a single one. Booshit.

--

27 March, Saturday.
Went out with meinu/babe/chiobu/ah lian! Hahahaha. YaLing, Vanessa and HuiJun(?). Met Vanessa and HuiJun(?) at Tampines coz they've workkkkkkkkk. Went around with YaLing first to buy Charmaine's birthday present. God I swear if anyone buys anything for me like the ones for Charmaine I'll love him/her a lot. :D Went to Tampines 1 and got this uncle told us that got people died in Tampines 1. He like siao one leh, laughed immediately after telling us that. Then we kpo kpo go and see then really got people died sia. But all put pretty makeup one lo. One look also can see is fake one lah. -.- After that went to find the working people. ^^

Pictures with Vanessa, waiting for that xiao jie to upload then I'll post here. ^^

Siao eh Vanessa act one cute while tying her hair hahahaha.

Do I look like a roadshow girl??? o.o

Look look look! Do I look like one?!?! Walao I went out for the whole day for so long also nobody say anything lah then kanna comment. Hur. I'm not okay! I'm a good girl. Hehehe. And I look so fat lah where got roadshow girl so fat de? Even if I want to be one the company also don't want me lah. Hahahahaha lol.

Look pretty stupid coz I'm trying to make my eyes bigger. Like this, O.O

It goes to say that I look much better without showing my teeth right? The smile looks so fake lah!

Trying to act cute I don't know why. -.-

And my hair looks freaking long now and I'm hairpeeeeeeee heh heh. :)

Roadshow girl lai le!!

--

Realised that I camwhore a lot. Last time not like that, but now don't know why. I can take as many as I like sia, like really siao one lol. Must learn how to self control le.

And realised that I've changed a lot, and people seemed to notice it too. Like, I no longer listen to English songs and find it hard to communicate with people who listen to English songs. And I've few friends who listen to Korean songs and it sucks. Really want to have a balance of both English and Korean songs. Gosh, who influence me with Kpop seriously! I need Hey Monday and Paramore and Avenged Sevenfold back again! Someone, influence me with English songs again! Lol.

Currently listening to: Echo by SNSD.

Next update then.
Byebye. :)

Oh yeah.

2010-03-26T01:00:00.003+08:00

Changed my blogskin, blog song and now, update! Hehehe. Theme should be hotpink + grey, and I guess the only colourful part of my blog is my tagboard with yellow font. Lol.

I think I needa upload photos, where's all my readersssss?! It's okay. I update, I see. Hahaha. :P Anyway this blog is dead alsooooooo, the only thing that keeps it alive is Twitter? Lol. I think you can see me damn active in Twitter rather in Blogger. =/

Btw I found this video from Alton's blog and it looks pretty retarded. I mean, dancing in front of the audiences are pretty funny don't you think so? zzz I think I'm making no sense here. See it below if you want.

And she (a SHE okay) looks pretty much like a primary school friend of mine. Well doesn't matter, the only part of her that attract me is her hair. She cuts it (maybe) exactly the same as Key's one! Like omfg check it out.

See the video and remembers her hair, and compare it with this:

Similar not!

And she tried to do this:

but failed hahahaha.

Anyway, I think she's damn cooooooool lah dare to cut that hairstyle I also want be copycat go cut leh but I don't dare. Damn my guts. :( It's okay, I don't have to do exactly the same thing to show people who I love. Maybe I just go pierce the parts where Key pierced will do. :) But siao ah, he has like (countless lol) earholes I think I'll be the siao one if I ever go for piercing. ._.

Wait wait wait wait wait! One last thing. Those Kpop lovers, go see this for all the icons of your fav. idols! Much loves, kudos to Kpop! :D

K enough talk of K stuffs. HOW ARE YOU PEEPOS OUT THERE?! I'M FUCKING FINE YOU KNOW. :D :D :D YOU KNOW I DO MISS PEOPLE AND YEAH, YOU'RE ONE OF THEM. TAG ME AND SAY YOU MISS ME YO COZ I MISSXCZXCZXCZ CHU! :D

Oh oh, I think I'm in love with pink muahahahahaha. Weird leh, I only always change my sub-colour but never my fav. colour - red. :) And yeah, meeting 4D peeps at night + YaLing Vanny Char on Saturday. Like omfg, finally yeah. :)

BYEBYE SUCKERS. :P
Next update then. :)

Stand By Me.

2010-03-23T04:06:00.003+08:00

Hihihihihihi me now is crazy already coz it's 4:07AM and me haven't sleep yet but me have no school yet so who cares hahahahahaha. Siao.

So high high high now coz I just realised that the song Stand By Me is sung by SHINee omg omg omg. All along I thought is sung by SS501 one okay. Now so hairpee that it's being sang by SHINee lol okay I know this Boys Over Flower show is like so last year and yeah, I now then know the song so what? Shut up. Hahahahahaha. K I really going crazy liao. -.-

Yeah just put the song Stand By Me as my blog song, but it just can't seem to autoplay leh. zzz. Kept repeating it @ Youtube. (Y) Most of the parts are sang by Onew and Key and I like! (L) So in love with this song now, what should I do? ♥.♥

Going out with pretty girls again - YaLing, PeiShi, JoJo & class 4D outing! Sososososo miss the class lah. And my girls! ;)

K shall come and update again soon, nightz!

Life's been great so far.

Luvluvluv KeyKimKiBum, ShinDongHo & YangYoSeob.
SHINee, U-Kiss & B2ST. ♥♥♥

It spells Love.

2010-03-20T00:54:00.002+08:00

YoSeob is super cute~~! I swear I wanna bite him off!* (means too cute, something like that) Anyway, will post later. Just find this cute. Oh YoSeob, why do you have to be this cute? :D

If only Singaporean boys are like this. :)

EDITED:

Cracks Of My Broken Heart

YoSeob's version.

Onew's version.

TaeYang's version.

Omg omg omg, which version is the nicest? Wait, JoJo I know you'll say Onew's one. Hahahahahaha. Ahhhhhh all of them sound super nice lehhhhhhhhhhhh, how??? :( Aiya, I think I listen to the original one lah. LOL.

Love Key Onew YoSeob G-Dragon DongHo, U-KISS & SHINee :D
Missing my friends, you know who you are. :)

We'll shine together.

2010-03-17T17:36:00.002+08:00

Congratulations to GD, you've made it and I always know you will. :)
It's really worth to celebrate you know.
I'll pray hard for you for everything to be smooth from now on.
Love & Respect, like you and Jay always say. ^.^
VIP + Hottest = Love & Respect.

Found this rather cute, wanted to retweet but nah.
So I'll just post it up here. ^.^
Shine a light!

That's all, missing people right now. :)

Living in a world of fools.

2010-03-15T01:22:00.002+08:00

Please fucking believe me that I'd just seen SHINee at Singapore Entertainment Awards @ floating stadium @ Marina Bay yesterday and oh my godddddddddd, they're super hot. Hotties of the night. :) And I felt super bad for other singers because a lot of people just went off straightaway after SHINee's performance had ended, especially Eason's performance. And the reaction of the audiences to the singers on stage, oh my. x(

I had actually recorded live of SHINee's performance but don't feel like posting up because it's very messy. x( But you can just click here to sing the performance of SHINee, absolute HD and I like! (Y) And Onew's fancam, hahahahahaha. :)

Grabbed from Photobucket, not from yesterday's performance. :)

He's a real hottie yesterday, can't forget his looks. ♥ Still can't get over the fact that I'm part of the SHINee's live performance, what should I do now?!?! And shit, missed participating in today's IMM showcase. x(

Have lots of pictures stuck inside my phone right now, but feeling lazy to upload. LOL. I'll find one day and upload all of them up. :)

I'M MISSING:

KEY KIM KI BUM
SHIN DONG HO
ONEW LEE JIN KI
SHINEE
PEI SHI
YA LING
SHA'ABANIAH
JUN LIN
VANESSA TAN
VANESSA KUAH MIN YI
ALEXANDER
U-KISS
CLASS 4D
PRIMARY SCHOOL FRIENDS

Not in sequence, just write out whatever I think of. And yeah, I'm missing them right now. Meet up sooooooooooooooooon? :)

Last but not least, my hottie ^.^
(L) his smile. ♥♥♥

The killing note.

2010-03-05T21:27:00.003+08:00

http://conspiredaffair.livejournal.com
http://conspiredaffair.livejournal.com
http://conspiredaffair.livejournal.com

:)

Build me up.

2010-03-03T13:14:00.002+08:00

Now you're gone, what am I gonna do?
I'm so empty: My heart, my soul can't go on... Go on without you...

Jay, I'm sorry, I'm not that strong enough.

Finally, it had all been decided. You'll never come back. My heart hurts for the past few days, from all the issues. It's never that complicated before, but now, I know the results. I thank God that you'll never ever return to that company, never return to your so-called brothers, but regret that I'll never see you again. Everyday I'll wonder where you are, what you're doing, how are you etc. The missing never stops once...

Still miss you Jay, and will never forget.

Not strong enough.

2010-03-01T23:48:00.002+08:00

Yes! Another update after so long. :)

Yesterday,
Happy Birthday Edwin Weeeeeeee! :D
You this old man! Older by 1 year old le wor. Don't forget me okay when you go into TP and see all the chiobus hor. Assholeeeeeee, :D

Last day of work! Work late shift somemore. Super no mood to work already, so in the afternoon went around disiao-ing people in Isetan with YaLing and Vanessa. At night, even worse. Felt like sleeping and walk around, don't even want to do cashier can! Heng I tahan the 8 hours, but I think I could just die there lo! Ass. Hahaha.

Today,
Happy Birthday KokHua! :D
Hope you enjoyed yourself today. :)

Went out with YaLing, SiQing, Nicholas and Ivan. Damn, the atmosphere... Anyway, watched Dear John and believe me, I slept during the show for the first time. Yes, first time. Anyway, the movie was boring. After that shopped around in Tampines before heading down to Bugis. The atmosphere starting to get better and I think it's fun in the end. Had a nice day with them today and looking forward for tomorrow. Ajisen and Ikea! :D

Posting this coz I want myself to remember. Okay, I owe JoJo money. Someone please help me to remember it. I need to return her!!! SHINee!!! :D

11 letters, one name.
Never forget.

Lost like a fool.

2010-02-10T00:33:00.002+08:00

07Feb10
Happy Birthday Sha'abaniah!
Though we didn't go out on your birthday, but I hope you had fun with your friends. Meetup soon if you're free okay? Love and miss ya. :)

09Feb10
Happy Birthday Haikal + Joey!
Hope you enjoyed yourself. :)

CNY is coming real soon, but I feel like I haven't do a lot of things yet lei, why ah? Shit, I'm like haven't shop for clothing, shoes and accessories too. And I'm doing my hair tomorrow. Gonna prepare myself damn well for a new start. :)

Yea, the appeal failed. Yea, I'm still going to RP. Yea, I'm a RP student. So what?

Been bottling up lotsa things but I don't know where to start and who to tell to. I know it's bad and unhealthy but what can I do? Anyone please tell me what to do. Please please please.

Off to bed now. Just now actually can sleep while watching tv. Wth hahaha. Guess I'm really been drained out from work. :(

K byez.

Run the k way.

2010-02-05T01:52:00.002+08:00

I'm so excited. HAHAHA. Crazy, fucking scared for the appealing results la. So many what ifs inside my mind now. Awwwwww, don't wanna want to know. But anyway, I've work in the morning too so ya. And working at the concourse!!! With the Jean Perry people!!! Omfg I can just go bang wall. And I've seen my next week schedule - Jean Perry Sales, IDM (don't know wtf is it) Sales, atrium atrium and more atrium. And OTs next week. Gosh, suddenly hate work so much.

Omg I'm still so hooked over Corby. Should I buyyyyyyyyyy?

Yesterday saw hell lots of people. My day man. ^.^

And Sha'abaniah! I miss you man! I don't think we'll have the time to meet up again anymore since you're busy with your JC life and I'm down with my work. I hope during March I can get to keep in touch with you that often. Miss you friend. Miss me too k. Winkwink* ;)

And I seriously don't know what's wrong with me and winkwink*. Just addicted to it. LOL @junlin. Winkwink* ;)

And crazy me went to sing songs in front of the customers, and all of them gave me a "Whatthefuck?" look. Cb, see what see? :D

Oh yeah.

2010-02-01T23:29:00.002+08:00

Oh yeah. Happy little girl today. :) Wanna go shopping soon. Anyone? Hehe. Had plans in my head le, wanna carry them out soon, before CNY? Anywayyyyyyy, I've been feeling very weird. The feeling of happiness overwhelmed me. Ya'know and understand?

Jean Perry Sales!!! Heart sank. Jean Perry people all so gl one. HAHAHA. :P

And Junlinnnnnnnn, meetup on Wednesday night okay? :D

Suffocating.

2010-02-01T00:21:00.001+08:00

So many things I wanted to say, but I can only swallow all of them down into my stomach.
Why?

Life is hard. I can't complain anything.
Today, I cried again.

Sometimes, I'm just not as tough as what you think.

I need a replay.

2010-01-30T23:39:00.001+08:00

Went to Bugis with Vanessa, Jackson and Shawnnehhhhhhh. :) Watch Tooth Fairy. Yea I want to knock some of my teeth and put them under my pillow also. I wanna get money. Heh heh heh. I want to watch Sherlock Holmes!!! Who wanna watch with me? Walaoz today my money don't know spent till where lei, now left pathetic $2 in my pocket. So ke lian, I want ka-chings faster comeeeee. P/s: NYDC is nice. :)

Went to meet SHINee @ Changi Airport. Crowded yo. Cramped together with them. Chit-chatted with other fans while waiting for SHINee to arrive. So many people shouting Taemin, Minho, Onew but not Key lo walao. But still got a lot of fan boards for him, yea. Y^.^Y Actually I was quite at the back of the crowd de, then don't know why kanna squeezed in and at the front liao. LOL. Then took video of them, and the atmosphere was nice. :) Onew was super fair and tall in real life, and he smiled to us! Omg I can just died there. But he was limping. :( Hope you get well soon! And I didn't get to see Key. :( Key ah~ They're having fan sign @ Lot 1 tomorrow. I wanna go! But I've work! So JoJo, please tell me how handsome Key is okayyyyy. :) Let's just stay overnight at Lot 1 now. Hehehe. And damn it, today they had press conference at 11 and I missed it! @#$%^&*!

Videos below~ :)

Can't let you go.

2010-01-26T21:39:00.002+08:00

I probably didn't know how I was on the first day, how awkward we were. It feels like it was just yesterday. Would you remember the brief moment we were separated, how hard it was for me to fall asleep, how hard it was for me and my feelings, the days I always looked for you?

As our memories get bigger, one by one, I get used to being by your side. I find myself looking for you. These lacking moments that I've prepared for you, you are only deserving of the prettiest things.

One thing that I'm sure of, is that we have to be together to smile.
Is this love?

I'll cherish you and protect you. Even if the winter snow that resembles you all melt away, I want to be with you like right now.

The day I finally know my feelings, I want to share it with you.
I think it's love, I think this is the start.
You and I.

We fell in love~ :)

Tell me a lie.

2010-01-24T22:24:00.002+08:00

This week's gonna be hectic, but heng I've two off days. ^.^ Anyone wants to go out with me? Haha. Lots of sales coming in soon. Chinese New Year is round the corner! Gonna buy pretty clothes and dresses? Haha. Gonna buy a lot of things coz money is rolling to me this week. :D I can see $$$ everywhere in my mind. Hahaha. People around me have been nice to me. Constance, Joyce, Susan, etc... (:

Onew fell off the chair in Idol Maknae Rebellion. JoJo did you see that? And Key, don't be sad. Hope you'll be okay soon. Take care! <3

Wakao today in the train for this stupid china woman sitting with her boyf. Then machiam like having sex publicly like that. Wtf. Go get a room if you're so despo please. -.--'- And that stupid bimbo kept playing with her handphone cover "clark clark clark clark clark..." Stupid bitch.

Sian nothing to do liao my fucked up brother wants to use the com now so should I let him use? zzz. I hope he goes into NS again hahaha. K evil but whatever. ;)

The major star has fallen...
And yet I could do nothing but to curse the reason behind it.
I'm sorry, if only you're still around.
Because I miss you. <3

Unlucky.

2010-01-20T01:35:00.000+08:00

100th post.

And I'm not happy.

Not going to post anything here, perhaps somewhere else.

Ya'know?

And I'm feeling lousy.

Sorry. :'(

Off track.

2010-01-18T11:21:00.002+08:00

Very long didn't use the desktop already, thanks to my fucking brother. He damn fucked up. -'- Same as that bitch. Later going to have work! Working with that bitch. Gosh, I so not going to see her. So what if there's a shortage? It's not like I'm the only cashier at that counter, you're part of it also what. Sekali is you're the one who kanna the shortage but you don't dare to admit so you push everything to me. You scared what? Okay lo, the most I take everything la. The most I sign the pink form lo. Go around telling everyone to be careful of me for fuck? Nb ccb, fucking bitch. -'-

Onew scored well in school! JoJo you're happy now ah~ :D

Hehe I heart you. :)

There's something special in you.

2010-01-15T22:01:00.002+08:00

Happy Birthday JUN.K!

Sometimes, things doens't turn out the way we wanted them to. However, we could find every means and ways to make them into the way we wanted to, if we want to. Unfortunately, this logis doesn't apply to you. To me, there's no such thing like "U-Turn".

Somehow, I'm quite sick and tired of my work already. Stupid bitch kept on picking on me for I don't know a fucking why and I've to work with her one day next week. Oh fuck. Just by thinking about her fucking face I'll want to puke already. Not that I'm evil or what, but whatever I want to say is none of your business. Don't come and be a fucking bitch by eavesdropping what we're saying. Wtf. Seriously, nobody likes you. HA!

I don't feel like sleeping. I want to keep using computer. I don't know feel like working, but I want to earn money. I want to listen to the song again. I want to meet you personally someday. I don't know what to do now. Life seems great yet boring. If only everything in my life is going smoothly now. You looked perfectly fine to me, and you sounded great. Good, all the best for the both of you. :)

I want to go Temasek Poly. I've the urge. Oh God, please let me enrol into Temasek Poly.

Kpop is growing in me. 2AM + 2PM, SHINee, SNSD, BIGBANG, BEAST, F.CUZ, 4 Minute, KARA, After School, T-ara, Super Junior... Omg I love Kpop.

And I love WooYoung. :)

You're history.

2010-01-15T00:10:00.003+08:00

Happy Birthday Jun.K!
Love you, but I love WooYoung more.
Kkk. :)

Am not going to care a hoot about you anymore. Coz we're o-o-o-over, love love is pain (LOL, Mystery). And yea baby, you're history man. :)

Omg am I thinking too much? I hope I did think too much. :x

K not going to bother much, sleep!

Cross the line.

2010-01-12T23:09:00.002+08:00

What I want to say now is, it's year 2010 already. It's time for me to keep what I'd promised myself since last year and fulfil it. And yes, I did. :)

I'm going to polyyyyyyyyy! I'm going to meet and make new friends! I'm going to be seventeeeen! LOL. I'm going to meet up with all of my friends first before losing all of their contacts.

Sleep, sleeeeeeeeeeeeeeeeeep!

Your big lie.

2010-01-10T22:10:00.002+08:00

BIG THANG TOMORROW.
And hell fuck, I'm not worrying about it at all.
Wait, maybe when I step into the school hall, I will.

WHATEVER. I can't be bothered anymore. I just can't.

I ♥ Irene Khoo, Christine, CheTiang, Susan, PohSuan, Diyanah, Shereen, YaLing and TingTing. Happy working in Ladies' Wears. :)

I ♥ PuaySee, Sha'abaniah and Vanessa. Awesome friends! :)

Life's great, isn't it? :)

Take only half of yesterday.

2010-01-08T23:13:00.002+08:00

Yea yea, call me Fannie. :)

Work was enjoyable, at least people now are better and I like! More new staff came and YaLing is in Ladies' Wears, same as me. :) But she worked before so ya. And oh my god 'O' Levels results is like in this upcoming Monday and oh my god, I'm like so not going to take? Damn it, I don't know why I'm so scared too. Well, just hope that everyone will do well for it. I pray hard for you all. :)

Today worked at concourse. Hell boring can. Except that I saw Reach and WeiLong, and Mrs Lim, and Ong YongSheng! Haha. Chitchatted with YongSheng for awhile before knocking off from work. Tomorrow's working again. It's like I don't even know what date it is anymore. Everyday just pass by like this - Wake up, go work, come home, use computer, sleep. Everyday like this. No life eh?

Anyway, went back to Choir on Wednesday. Had Sec 1 orientation. This batch of Sec 1s aren't that bad as what I'd expected but who knows, in the near future? Met up with Sha'abaniah and gosh, I missed her greatly can! Caught up with her about each other and met Shawn Soon and Jackson. Went to have dinner with them + a few more band members before heading home. I had fun with them and it's been a long time yo. zzz. Sha'abaniah! Thanks for your present, I love it but I can't use it coz I've work. :( But don't worry, I won't let it collect dust. :D Shawn Soon, better meet up soon okay! Haha. Jackson! Don't always jio girls hor! Hehehe. You can't scold me coz I don't have tagboard. HAHAHA. Evil right? ;)

I'm happy in 2009, and I know I'll be happier in 2010. Because I've friends like PuaySee, Sha'abaniah, Vanessa, Shawn Soon, Jackson, ChiaWei, Eunice, KaiHui, Justin, YongSheng, JunTing, Shawn Woo and WeiXiong who were always there for me and will be there for me always. Thank you! ^.^

Not forgetting my sister, Jer 재범♥ & you. :)

I'm going to forget the sorrows in 2009 and only keep the best in my heart. You know what I'm talking about uh-huh. ;)

Say you know it.

2010-01-05T23:58:00.003+08:00

Yay I got it! With my own pay okay! Not feeling heart pain though. Just feel that I should buy Corby first. Damn.

And next I'll get this. But this one compared to my current phone, no Wi-Fi. But nevermind, I don't need it since I've ITouch. :D Hahaha. Guess what colour I'm gonna get?

Been having lotsa OTs these few weeks. Hope that this month's salary is enough for what I'm gonna buy. Going to school tomorrow, can't wait! I'm kinda missed school yo. Missed the times when we'll be together, joked around with teachers, and be serious when it comes to work. Everything is 2009 is just so nice, and I don't think I'll ever forget anything in there. But I know, 2010 will be better, and I'll look forward to it. :)

And yes Sha! I'll be seeing you tomorrow. :)

Didn't meet up with PeiShi to go to work nowadays. Missed her. But nevermind, I can meet up with her on Thursday. :)

Missing you W. :)

No longer the same.

2010-01-02T00:34:00.003+08:00

Heh, 2010 is here! Though I'm late, but still I'd like to wish everyone a Happy New Year. May everyone stay healthy through the whole of 2010, and be happy always. Always look forward in 2010 and smile. :)

2009 I really learnt a lot of things, and also found myself. Found out the stuffs that I like and dislike. Reborn-ed my hair and found a job. So now at least I still get to go to work with PeiShi and WeiLin. Mommy bought a new desktop, then followed by a notebook, and let me had a new phone. I'm a happy little girl hehehe. :)

And yesterday I got my pay, happy little girl. :) Today I spent some on food and clothings. Uni Qlo is nice, I wanna go there again. I wanna buy Guess wallet too, and ITouch and SamSung Corby. Should I buy ITouch or Corby? Hmm, I need advise.

Walao I wanna watch movies. It's been like months since I've went to cinema. I wanna watch. Next Wednesday, anyone? Also, results are coming out soon. I'm starting to feel afraid now coz I'm scared that I might disappoint my parents. And also, I don't want to repeat another year. Pray hard for me yea? :{

P/s: I miss Sha, Vanessa and W.

2009 was great, and I believe 2010 will be better. :)

5 Steps

I don't know how much longer
You're going to be here
So I say my prayers every night
One for my mother
One for my father
And one for the love of my life

So if you decide to leave today
Then leave tomorrow at the door
And take only half of yesterday
And forget all hope for the present
Cause it just went away

We were 5 steps
From eternity
We were 4 steps

4 steps past love
And 3 wishes
From touching the heavens above

Another day is gone
Another night now dawn
Waiting patiently
Hoping you'll return

But not before long
When you say goodbye
I still feel your presence
In my bed at night

And what was reality once
A love true in form
Has now added pain
From a man's scorn
Forced to wear the memories of pain
Around an empty heart

Now I sit in silence and begin to think
As laughter echoes through the air
I can't get you off my mind
But a whole new love
I could never bare

So now I lay
Me down to sleep
And I pray my Lord my soul to keep
And if I die, before I wake
Then I promise I'll be there for you always

We were 5 steps
From eternity
4 steps
4 steps past love
And 3 wishes
From touching the heavens above us

It's dedicated to you, J. ♥

My life is coloured with you. :)
Saranghae. ♥

Empty heart.

2009-12-30T21:17:00.003+08:00

I'm tired. Physically, yes of course. Emotionally, yes. I don't know what I'm tired of, just feel so...

2010 is coming. Hope it's a good year for everyone. Bring along the good ones from 2009 and abandon the rest in 2009. May everyone be happy. :)

The song 5 Steps is nice, especially it's being sung by 2PM. :) :) :)

Don't ask me why,
I just know you're the one.

Time will prove everything.

2009-12-27T20:56:00.002+08:00

Had so many feelings mixing together now, like rojak like that. Been thinking a lot these few days; in workplace, at home, everywhere; the past, the present, the future. These few days were okay, and I'm getting my pay soonnnnnnn. :) :) :) Didn't know that I've work for 3 weeks le, hahaha.

Here's a wish of belated Merry Christmas to everyone. Merry Christmas Jay, and J. And you didn't surprise me today. :(

Happy Birthday TaecYeon! :D

Woobabybaby. :)

5 ways to say I love you.

2009-12-23T23:19:00.002+08:00

X'mas is coming! :D :D :D And I've OT on that day. :( :( :( Planned to celebrate with people but... Guess I can only celebrate it with my colleagues. :(

I'm getting my pay soon! Next week hehehe. And I didn't know I'm going to work till one month le. Just like keep working working working then poof! one month soon. Had thoughts like quitting this job this month, but now I'm not sure. I think I ask PuaySee first. If she wants to quit too then I think I'll quit with her. Then WeiLin! You'll be the only one left. Haha don't worry, I'll go Guess there buy wallet from you. Hehehe. :P After getting my pay, I wanna buy lotsa things! Lotsa lotsa things. :) :) :)

There's this customer asking for plastic bag. She don't want the nice red paper bag and instead she wanted the "noisy" one. I was like "huh?" then "oh!" and gave her the plastic bag. So cute, the "noisy" bag. Hahaha. Oh, and I made one of the printing machine cannot function. Felt so bad. :'(

Overall, the people in ladies' wears are nice, especially the promoters. :) Hahaha I complained about the boring-ness in Mango. I kept complaining to the part-time staff there and the cashier that there's no customer even though the sale period is still going on. Then I think the assistant supervisor heard me or what, asked me to go back to ladies' wears because there lack of staff. Hehe so I happily went back lo. Not my fault hor, it's the fact. ^.^

There's this Mango part-time staff that looked like GaIn lei. Really look alike lo. But JoJo said doesn't look like. :( Then I kept staring at her. Haha. She's really very pretty. :)

K la I think I gtg liao. Missing people and JWY. :)
Byebye.

Will you surprise me on x'mas day? :)

Secret time.

2009-12-23T00:14:00.002+08:00

It's coming!

Come a little closer.

2009-12-17T01:31:00.002+08:00

Mango sales is officially on. Had OT today. My legs felt like they weren't mine now. Breaking into pieces, feeling so damn numb. I wonder whether I can really pull through 3 months or not coz it's not even the first month yet and I'm super tired already. I really really considering quitting the job already. Oh god. But I feel that I should endure all these. Advise, anyone?

Anyway, I feel like shoppinggggggg. I feel like going gaigai and indulge and dote on myself. I want to compliment myself hehehe. I want to buy lotsa lotsa clothes and go play and eat. :)))) Christmas is coming but I'm working. Argh. )x

Super tired but I don't want to sleep. Tomorrow's working again. Mommy!

Replay.

2009-12-14T20:32:00.003+08:00

Happy Birthday Onew!

Work was tough, being a cashier was a no-fun thing. Don't understand why people like to do cashier when I find it to be difficult and risky. It's like, you don't know when you'll have excess/shortage. Sometimes when you've counted and it's balanced, the accountants will say that you'll have excess/shortage. Scary sia. But no choice, I'll be cashier everyday. )))): The people there are nice, except a few. Diyanah and Shereen will be leaving this month, will miss crapping with them. And I'll be the youngest there already. Anyway, I'm considering quitting by this month and find another job. (:

Brown Eyed Girls came to Singapore! Rawr, Diyanah I want to go and seeeeeeeee. D:

Walao it's only a month and my hair starts to curl already. zzz, spent so much but it's still the same. I wonder whether the auntie got cheat me or not. Walaoz.

Tomorrow going out with Weilin and Shuqi, can't wait! Watching New Moon muahahahaha. But I want to watch 2012 lei. And Case 39. And lots more. :(

Sha ah, where are you now? Please text and update me asap, I miss you!

I can't breathe when you're around. :3

I'm so strung out on you.

2009-12-07T02:00:00.001+08:00

Hectic hectic! Heng tomorrow I've off day. :D :D :D But after tomorrow gonna work everyday le. D: D: D: Work ah~ Weilin's working tomorrow, sian if tomorrow I'm working maybe still can know where she's working. Haha. My junior wor~ :P My colleagues are nice, especially the two Malay ladies. Gosh they're superb pretty~ One of them is mixed blood, pretty girl. I'm envious hahaha. But they're going off soon, pretty sad and I think I'll miss them. :( And I'll be the youngest there already. :O

Anyway. I'm very scared lei. Coz my seniors their legs have the green veins come out already, then I scared later I stand too long also will like that sia. Omg, I scared. :(

Eh tomorrow (Monday) I off, who's free huh? :D

You're the sweetest drug.

2009-12-04T01:43:00.002+08:00

Because of you; 3mins48s.

This week was hectic, and more to come soon. I found joy in my work, good or bad thing? Sad that I'm not in the same place with Puaysee. She's in Tampines while I'm in Scotts. LOL no la, kidding. :P We're in different shifts too. Can't see her around and that often. :( And congrats to Weilin for getting the job. :) You'll be my junior very soon muahahahaha.

Don't think I'll come and blog that often already. Anyway I've thought of deleting my blog away since there's not many readers and I couldn't blog much already so ya. Still thinking lahhhhh.

Never knew what we were missing,
but I knew once we started kissing.
I found you. :)

Fight the bad feeling.

2009-11-30T04:23:00.006+08:00

Look at the time! Hah, nothing to be great about. I can't get to sleep, and I spent some of my time doing this new blogskin. Comment, anyone?

My left eye is itchy. Feels like some mosquito had attacked me LOL. I need to get rid of this itchiness! )x

I think it's time to reply tags. x.x
-----------------------------------------------------------------------------------------------------------------------------
Chiawei: Cheerup:D HAHA
Chiawei: HI;D HAHAH Good luck for ur O levels:D :D:D:D:D:D
Reply: Eh! I think I very long didn't see you le lei. Go create a new blog lei. No blog = totally lost contact lei. At least in your blog there's still a great thing called tagboard to keep in touch lei. Hahaha. Hi my friend. (:

jUnz-_<™: YOSXZ! How's life? Busy studying? Come out soon yeah, on 31st Oct? Lol. Good Luck for your 'O's!
jUnz-_<™: Helloooooo! 3 more days! (:
jUnz-_<™: Aiyo you suddenly go off. Actually still got one card for you one!
Reply: Eh! I yet to say thank you to you for the present lei. But hor, I don't know where to put la. Tell me where to put lei. =/

Yapyee: Of course! Good Luck for your Exams!
Yapyee: Hi ! today cnnot see you all!
Reply: Cousin ah, I'm like can only see you once per fortnight lei. Then now you have job liao, it will be harder for me to see you that often le lo. ):

Jackson: Hey thanks for today aiights. it was a funny movie haha. Ohoh hi ******* i'll keep it a secret k heehee
Jackson: Jiayou for O's ok? TAGGED! Dun Update! Study hard!
Jackson: Yoyo TAGGED!
Reply: Eh you stalker is it? Haha. Go Cambodia and don't come back hor. Haha joking joking. ^.^

Jiajie: Cheer up Gal
jiajie: hey. Happy birthday to you. Cherish my present hor. Hahaha
Jiajie: Erhm Hi and Tagged
Jiajie: Erhm Thats not me. Who is that guy sia??
Jiajie: Sorry FY. I dunno who the hell is he. Sorry
Reply: Eh you another stalker is it? Haha. I cherish your present like siao hor. You don't know when my dog wants to bite it I hit him lei! Haha no la joking. The pooh bear is lying on my bed nicely. (:

edwin: -_-lol eh dam long never tag people liao
edwin: tagged (using your laptop)
edwin: hi asshole
Reply: Eh asshole, finally update your blog liao hor? Hahaha. Continue to update ah, but hor I don't think your readers will come back liao. Hehe okay I very bad. You must be cursing me right now right? Haha. Hope you attract your readers back ah. ;)

junlin: Jiayou jiayou! You stare at my paper during exam! O:
junlin: Hope you had a great Halloween birthday (: I updated my blog. Heh.
junlin: sianz, yours end liao, mine tomorrow then end ):
junlin: Heyxzsxszxz my regular tagger! O levels finish liao, but I see no flood. Haha.
junlin: (:
junlin: LOL!
junlin: JIAJIE! HAHAHA.
junlin: Hahahaha. Fengyi, you've been hiding things from me? D;
junlin: Updated (:
Reply: Hi my regular tagger. (: Sorry lei I think I'm a bad tagger lo. Not tagging your tagboard regularly. Sorry lei. ): Don't hate me hor, at least I got keep my promise of flooding your tagboard. Hehe. Nice flooding right? ;)

zhenyang: happy bday fengyi! Hope u grow taller. haha. Wish u 2 times le hoh. haha.
zhenyang: never miss me la. Wa lao . nice shortie(;
Reply: Don't need me to miss you la, you got *ahem* to miss you lei. Haha. Go Cambodia and don't come back hor. Hehe joking. Have fun there. (:

Vanessa: Happy Birthday Butt! Halloween babyyyyyyyyyyyyyy!
Vanessa: Hello! Life after O level very sian uh? Go shopping soon! ^^
Vanessa: Yooooo! You starting work soon leh, how to go out?
Reply: Eh Butt-butt, see when you want to go out lo. Then I arrange the schedule a bit, just for you hor! :D

wei lin (:: happy sixteen b'day sista. finally ur turn to turn old. hahas.
Reply: Sist tag me more lei. Haha. You go put a tagboard also lei. Cannot tag you I very pekchek lei! Haha.

kaihui: heys! hahs are you talking about me? wahahaa
Reply: Hihihihihi! Sorry that I didn't go eat with you all on the Friday night. Meet up with you soon okay. By the way, update your blog ah!

LOUISA: SAUSAGE! <3 style="font-weight: bold;">Reply: Sausage ah, tag me more please. Hehe. I miss you like don't know what ah. Hope to see you soon. (:

SHERLYN: HELLO FENG YI !! LOVES !! ~~
Reply: Sherlyn ah~

Jia Jia: hello FY (: thank for the books (: !!! Tagged (:
Reply: Jiajia, you and your sister are the best. I think that's all I can say. Haha.

J.Amity: K-POP FTW!
Reply: YAH! KPOP CONQUERS THE WORLD! :D

cheryl: OOOH, thanks!
Reply: :D

pUaysee: lolz..my dear girl..we're workinqq half a shift only lurrh..dont worry yea =) takecare
Reply: Hey babe, cya on Tuesday yo. (:
-----------------------------------------------------------------------------------------------------------------------------

My readers, where are you!!!! Shall attract all of you back. Hehe. But but but but but, spammers/anonymous is to be ignored. So please tag with name. (:

Tomorrow starting work, byebye my freedom. ):

Hope to see you in my dream tonight, and hope you will see me in your dream tonight hahaha. :P

I miss loved ones, and J.
Byez.

xoxo.

2009-11-29T17:01:00.002+08:00

!!!

I'm starting work in 2 days time. How time flies. Money will begin to roll in soon, can't wait! I'd planned what to do after next month, typical me hahaha. Hope I won't be a spendthrift anymore. I must really start saving money now already, coz enrolling into Poly requires lots of money. But the thing is, will I get into Poly in the first place? Hmm, let my results decide. :)

I'm starting to feel scared, of everything. In addition, the aftermath of watching Paranormal Activity - Paranoid. I'll have this feeling of someone watching at me at night when I'm sleeping. Prove me wrong.

I miss everyone, and J.

Byez.

I'll be there for you.

2009-11-26T02:37:00.002+08:00

100. Because I know that you are definitely going to return.
(100 reasons why I love you)

It seemed that I'll only go out once per week. So, yesterday I went out with Sha and Edwin. To watch Paranormal Activity. Pretty scary, most of the scenes were being missed due to my timidness. ._.

I miss everyone, Choir, and J.

Y.

2009-11-24T00:43:00.003+08:00

Happy Birthday Cheryl! :D
Even though you're younger than me by 24 days, you're still as old as me already hahaha. :)

I'm adapting to my weird fringe now. It's still look funny.
Starting work next week, not anticipating to it anymore because I suddenly feel like gaining more of my freedom back. But on the other hand, I still can go work together with Puaysee, which is one thing that I'm looking forward to still. But, I still want to play a little longer hahaha.

Zzz I don't know what I'm talking about now.

I don't know what to say.
But I want you to know,
that we'll go through this together.
And he'll be back soon, so don't worry. :)

W.

2009-11-21T17:23:00.000+08:00

I don't like my fringe! It sucks a lot now. )))):

By the way I dozed off several times whenever I've free time in the salon. Heh heh. :)

J.

2009-11-20T01:08:00.002+08:00

If our love is a book,
this will be the last page.

This week spelled boring. I can't stand it anymore, so I went out with Puaysee to eat today. :) Heh heh, had so many things to share and had so much fun with her. Went around Singpost even though there's nothing much to see but miraculously, we spent 2 hours there. Going to work with her soon, anticipating that. ^.^

I'm missing a lot of people now, I wonder what they're doing. =/

Sha ah, where are you now? Don't fly here fly there lei, I don't know where are you now. I miss you a lot. I missed going out with you and crap our asses out. Haha. Faster text me when you're in Singapore okay. :)

I'm going to spend my holidays with work and nothing else. I want to go shopping too~

J. <3

You will come back,
and I'm going to wait.

Forever is over.

2009-11-16T18:10:00.005+08:00

I still have blisters all around my both feet! Pain sia. T.T Anyway I'm craving for dried mangoes now hahaha. That's random. ._.

Days ago, 2pm's comeback album.

1:59pm. It is, without Jay. I hope he will come back soon.

2pm! I think 7 members are better than 6 I don't know why, maybe I'm used to see the 7 of them together already. Now when I see the 6 members performing I feel weird. ._.

My favourite boy!

He looks cool in this picture, but there's one more which he looks very cute but I'm not going to let you see only for me to see hehehe. :P

Jay!

He and his memorable hairstyle.
I miss him and his cool performance...

You will come back,
and I'm going to wait. :)

Been spending weeks watching Oneday's videos, kept repeating too. The videos are nice, and their performances are cool too. Love them. :)

Run, and never look back again.

2009-11-14T22:39:00.002+08:00

Hehehe I think I'm into Kpop now. Look at my playlist, all K songs lei! Hahaha. I love 2pm. :)

Graduation Night was nice. Everyone was dressed beautifully and I think they had fun? Haha. Sad that people were flying off soon, and Yingying went off yesterday. Sad that I forgot to text her a farewell message. ): Well, hope you have fun in China babe, cya next month. (: Yesterday's outing was nice and tiring, coz I'm out for the whole day. Sorry guys for not being able to stay longer but I hope you all had fun okay, even though I know it'll not be fun without me la hahaha. :P And Ong Yongsheng I'm going to tell Yulin what you'd did to me yesterday I don't care. :P

My legs are hurting now, blisters everywhere. )': Stupid me went to wear those high heels on Thursday night then yesterday wore pumps too. I must be crazy lah. And my right hand is in pain too. Couldn't clench my fist I don't know and it hurts if I do so. Walao what's wrong with me sia. )':

I hope I can find a job pretty soon. :)

You might come back, you will.
And I'm going to wait.

This is not a game.

2009-11-09T21:16:00.002+08:00

'O' Levels is going to end in 2 more days, happy happy! :D Graduation Night is coming too, and more outings this week. Omg can't wait! :D :D :D

My friend said that girls should wear dress during Graduation Night, so I'm forcing myself to wear it now. It seems so weird, as I don't really like to wear dress. You guys didn't see me wearing any dress at all when going out right? So people, please don't laugh at me if I dress ugly or something coz I really don't like to wear dress. Reason? Coz I'm a chorlor (rough) person and have a "boy" character hahaha.

Nothing much to say. Lazy to update blog, not to say reply tags. Think shall delete my blog soon. :)

Wait till my next update, bye and miss me. :)

Whenever I see dried mangoes, it really reminds me of you and I would feel very upset.
I miss you, please come back asap.

Breakout.

2009-10-31T23:13:00.002+08:00

Fengyi's 16!
Yes I'm officially Sixteen. NC 16, here I comeeeeeee. (:

Omg I actually wanted to write out everyone's name but I think don't bah. Just want to thank (you) for making an effort to remember and wish me a Happy Birthday. Thank you! You know who you are. (: Wish you all the best in everything. People who are waiting for results, good luck. ^.^ People who are still taking 'O' Levels, jiayou! :D

Very happy, guess this year is the best year, though my birthday falls on mid 'O' Levels hahaha.

Happy Halloween by the way!

So gone.

2009-10-29T21:41:00.002+08:00

Ehhhhhhhhh the pictures are so damn cute! The dog dog in the burger. Haha.

Sorry for being random, just trying to share my joy with you. ^.^

Alright gtg byez. (:

P/s: Edwin asked me to update, stupid Edwin you better go update yours also hor! :D

More than you know.

2009-10-22T21:47:00.002+08:00

Ehhhhhhh 'O' Levels is finally here finally hor! Walao have to endure 3 - 4 weeks of exams and intensive studies till paradise. Haha thanks Pakteng for the message. (: Wanna thanks those who make an effort to wish me good luck heh I'm so touched! :P

Studying with usual people almost everyday. Now I'm like really super interested in studies and nothing else. Call me a freak or something I don't care, but just jio me go out and study and I most likely will go. Haha. Afterall I just have to endure about 1 month's time then till freedom. Can't wait to do lotsa stuffs after 'O' Levels. Is like I've alr planned out what to do after 'O' Levels way before the exam starts la. zzz, a bit kanjiong hehehe. :P

Kay nothing much to update anymore so bye miss me yo muackz. (:

The day you went away/over you.

When the world comes down.

2009-10-17T21:10:00.004+08:00

Since I'm free now I shall come and update my blog. ^.^ Next Thursday is the Science practical test, hope I can do well. *pray hard pray hard* Eh you also help to pray for me also hor. Haha joking. Very scared, coz everytime fail de my practical test. ): Sad. Anyway. Haha.

Okayyyyyy, went to Changi Airport with Edwin to study. He's a damn funny guy, hahaha. Talked cock most of the time, but he's helpful too. Haha thanks man Edwin, just that you don't be too gl then would be perfect. Haha. :P

Omg I'm so bored till I can die. Singapore is so small that now I'm thinking of going to Bugis national library and play with the lift. Okay so random but I feel like lei! zzz. I want IR to faster open then I wanna shop there! Aiyo I haven't go to Orchard Ion yet lei. zzz. After 'O' Levels. Haha.

Nothing better to do ah go reply tags liao.

junlin: Think it's cos I'm your regular tagger :D Woohoo.
junlin: Wa, sleeping? I agree. LOL! But really, I felt like I can just study forever when I was at the library. Didn't want to leave at 9 lor. Hahaha.
junlin: Anyway, I can't tahan liao. Too late at night, too tired. You sleep soon yea? Goodnight, God bless! (:
junlin: Regular tagging in action. Who's gonna spam? Or tag regularly just like me? Hahaha. Take care!
junlin: Heyhey ;D Nowadays I tag less ._. Sorry
junlin: cos I'm studying more ._.
Reply: Hey regular tagger! Haha it's okay man, I also didn't tag you that often le. Sorry. ._. When 'O' Levels are over, I swear I'll flood your tagboard man! Haha. Takecare, all the best! :D

Jackson: HeyHey! ;) Tagged! Watch movie must call mi hor!
Jackson: TAGGED! hehe tag mi back hor!
Jackson: U NEEDA UPDATE! :)
Jackson: Cmon u still got mi! :) cheerup or else... Hee hee hee :)
Reply: YOYOZ! Haha. Thanks my friend, you're really a nice person. Haha. Eh I update my blog is because of you hor! Hehehe be grateful ah. :P

LOUISA: Sausage! Relink okay! <3 class="pn_std">LOUISA: Sausage! <3 style="font-weight: bold;">Reply: Sausage! Relinked. LOVE YOU TOOOOOOOO. (:

Yapyee: Hello! Tagged
Reply: Hello cousin! :D

Yekliang: tagged again!
Yekliang: hey chill yeah... maybe u should watch "a msg to all haters" again! hehe...
Yekliang: although i have no idea whats it all about... paisae... >< Reply: Hello. You're very lame lei. Haha.

Vanessa: Hello Butt! Study session soon yeah? <3 class="pn_std">Vanessa: See! Today i so good, i go find you after my exams, Haha. Tan AH teaching somemore! ^^
Reply: Hi Butt-butt! Miss ya. xD

Kimberly: See-near! <3 style="font-weight: bold;">Reply: Zoo-near! Love you too. (:

wei lin(3: hellos ! tagged. u sounded so angry. dun so angry kays. relac.
Reply: Hello, thanks I'm not angry le. Hahaha.

Jiajie: Yo! Jiayous in your Os :)
Reply: YOZ! Thanks. Good luck to whatever you take too! :D

Jia: Hello fengyi (: !
Reply: Hello Jiajia! :D

Countdown to first 'O' Levels paper: 5 days.

Maybe it's best you leave me alone.

The only thing that keeps me wishing on a wishing star.
The only one that I think about every night.
Nevertheless, it's you.
I don't know what to do anymore.
As time goes by, the feeling goes by too.
I don't know how to explain this feeling.
Maybe that's what people call, love.

Fucking hate my family a lot.

2009-10-16T22:18:00.003+08:00

Look man. I'm not your dog, so please don't command me. What right you have to command me? You think just because you're older than me you can order me around okay. Like I've said, I AM NOT YOUR DOG. Fuck hell. What you do the whole day? Playing. Nothing but playing. God, if you have nothing better to do just go and do your bloody Army or get your ass out of this fucking house and stop hogging on this computer can or not!!!! I seriously had enough with you alr. I need this computer more than you. I need to print papers, and it's urgent. But what you do? Playing DotA. When I use just a little bit of the computer, you said you want to use. What the fuck. What? Now this computer is yours? I didn't say anything when sometimes you just use the computer for almost the whole day, I didn't complain. But when others just use for a few hours you started to complain. Sist and I had agreed to use the lower internet thingy, but you insisted on using the one more expensive one, which must pay $7 more. Since you suggested that, just please go and pay that $7 hor. Don't let Mommy pay okay. She don't deserve to pay this type of thing. Btw, since you're using the computer the most, just kindly help Mommy to pay the electricity bills. You're in Army now and you should be filthy rich, so just fucking pay the thing! You're a bastard if you don't do this.

Sad to say, last time I used to respect you. You've been a kind person to me in the past, and I idolised you as someone who I can learn and become to in the future. But now, you just made me detest and despise you more. You may have the highest IQ among the three of us, but you definately have the lowest EQ. You asked me why I so gl? Ask yourself first why you made us quarrel with you everytime. It's your attitude if you didn't know.

Fuck you brother, seriously you sucks.

Millions of ways to show Love.

2009-10-16T20:28:00.005+08:00

Graduation Day. I thought I would cry, but I ended up laughing and smiling away. It's a happy ending, didn't expect that.

I know if I want to say gratitude to people, it'll be long and worse still, they won't see. So I won't.

Went out with people, this might be the last time that we'll be going out, and I'm pretty sad. Sorry for my attitude, I know it sucks.

Kinda pissed off just now, but I know I have to curb my anger. Sigh.

Life sucks sometimes.

Fused.

2009-10-14T22:12:00.002+08:00

Okay I shouldn't be blogging at this hour of time but, whatever.

First, I have to say sorry to people. You know who you are. Sorry for my attitude, I know it's damn attitude. But I hope that you can understand because it's isn't what I anticipate for also. You think I want to scream and shout at you too? You don't feel good, neither do I feel any better okay. I think I just can't control my temper but I tried to, I tried to okay. Just, sorry.
I just hope that you'll look at my blog.

I think nowadays I'm under a lot of stress. Today Sha mentioned that I ate a lot, and partly must be due to stress. I think I must agree with her. These few days I've been indulging in studies, studies and more studies. I think I've neglected my family and maybe my friends too. Somehow I feel that they're no longer with me now. Maybe it's because of the different schedule and time slot, and I hope it's this way.

Graduation Day is in 2 more days.
Countdown to first 'O' Levels paper: 8 days.

I don't think I'm that well-prepared. But I really want to do well for this exam, and live up to the expectations of my parents, especially my Dad's. I hope I won't get carried away by whatever it is. Oh stress.

Lazy to reply tags. Been really busy + lazy + exhausted + frustrated + irritated, and feel like crying. Argh, pathetic me.

One thousand and one lies.

2009-09-27T02:47:00.002+08:00

The truth is cruel, so does the lies.

IT'S 2.52AM NOW AND I HAVEN'T SLEEP YET! :O

I'm watching the time ticking pass and soon it'll be 24 more days to 'O' Levels Science practical exam on Monday. Fast sia, I wonder how I've wasted my time. zzz.

Anyway, Edwin is an asshole. He never failed to guailan with me everyday. Idiot, wait till you cannot wake up tomorrow then I'll laugh at you! Hahaha. :P Btw he crazy one, what want to go study at library at 8am when it's 2.52am now. God is he crazy or what!!! :O

To you,
you're a total bitch. Though I may not listen to both sides of the story, but I do know what happened alright. You don't come and twist the entire story. The truth is that you're the one who started this thing, and now you're blaming him? Stupid sia you know what's "Dare to do, dare to own up"? Just admit what you've done okay, at least everyone will forgive you. But you just kept quiet and let others back you up instead. What? Now too timid to own up? Hah, what a joke. Since you have the guts to start all these things, just have the guts to own up okay. If you happened to see this, you know who you are. :)

And all those who help that person, please use your brain can. Don't just jump to a conclusion and say that "Oh, coz she's my friend so I must help her." Stupid la. If your friend is a murderer, will you still help her? Damn, I wonder why there are so many people who just spam other people's tagboard without thinking.

I don't care whether this offend you or not, but I think what I've said make sense. If you want to come and spam my blog, by all means man. I won't entertain kids like you coz I know I've something better to do, rather than joining you scolding each other. Lowlife.

Well well, 24 more days. Have been constantly reminding myself that. Get prepared yo. :)

Sorry lazy to reply tags. Will reply them next time. Continue to tag people!
Byez, <3

-

2009-09-20T20:39:00.003+08:00

LG GD900 Crystal

LG makes a bold step in the design category by introducing yet another innovative aesthetic concept, transparency. This crystal, glass-like phone proves that stylish design can be achieved not only with the use of vivid colors, but also by revealing the handset in its purest form.
The phone features a unique and completely transparent slide-out keypad, and comes with a matching Bluetooth headset. The GD900 has quad-band GSM (850/900/1800/1900MHz) support, and dual-band UMTS (900/2100MHz or 850/1900MHz) support with HSDPA for high-speed connections. The GD900 uses the S-Class 3D user interface, and it runs very smoothly on the device. The most captivating thing about the phone is its transparent keypad. Aside from looking cool, the keypad allows for innovative and useful gesture and multi-touch controls.

The chio-est thing I've ever seen. Look at it's brochure and you'll know what I mean.

I name it love.

2009-09-20T01:42:00.007+08:00

Hi world. Hi you. Hello me. (:

Feeling totally worn out by now. It's only 33 more days to first GCE 'O' Levels Examination paper, which is Combined Sciences practical test, the killer. Okay, later I'm gonna mug again. Life, life.

There's so many things that I wanted to say/ do. First, I wanna watch movies! It's time for me to take a short and actual break to relieve my stress. Hurhur. And I think that watching movies is the best, though shopping is nice too. :) And there are simply too many nice movies to catch alr, and more to come too. Awwman, time time time. ):

I find this hilarious. Was laughing the shit out of me when I saw this photo. Okay maybe it's not funny to you. ._.

Feeling lethargic now. Shall reply tags before going to sleep. ^.^

junlin: heyhey. C is for Chew Fengyi. ;D nice studying with you too. last few papers must chiong like siao arh!
junlin: heyhey regular tagger. the show nothing much one leh. or maybe i not paying attention to the tv. LOL!
junlin: hey yo! prelims finally gonna over. you good lah, friday free liao. i still gotta suffer. but i'm still tagging you (:
junlin: hahaha, thanks thanks :D good for you sia. go enjoy liao. 2 more papers for me! chiong arh! hahaha.
junlin: yo! ;D how're you? (:
junlin: prelims are O.V.E.R. LOL!
junlin: good luck for the results yea. hahaha. so how's holidays? (: take care uh, God bless! ;D
junlin: :D anyway, all the photos got the 'emo' element arh. cheer up if you're down!
Reply: Wow is it because I didn't reply tags for too long or is it you kept tagging? My tagboard's almost flooded with your tags! But thanks my regular tagger, thanks for all your tags. :D

♥ , AMANDA: tags! <3 class="pn_std">♥ , AMANDA: S E N I O R ! miss you lots yeah? luvs...
♥ , AMANDA: ohhohh,'be sure t come back some day alrights? Luvs! <3 style="font-weight: bold;">Reply: Hello my dear. (: Will go back to Choir as often as I can. (:

Chiawei: Goodluck for ur prelims;D LOL Study hard:D
Reply: Thanks thanks. You must study hard too. 1_? to 'N' Levels!

Jackson: No way im not gonna be regular! weeeeee Tagged~ good luck for ur O hor! dun get O for any paper hor!
Jackson: Your this post like super random and zilian LOL! especially the dun miss me part LOLOL! Tagged~ ;)
Jackson: Hey fengyi! Tagged~ :)
Reply: You idiot! Don't curse me lei. I'm gonna get straight 'A's for 'O' Levels hor! Hehehe. I like to zilian lei, cannot is it?!?! Haha.

jiajie: lalalala...
Reply: Hello! :D

sha: HELLO!!! >.< sha: eee... ner reply one.. hahaha! actually i also like tht! >.< Reply: Hi Sha! Haha now I'm replying you. You also didn't reply me de! =/

LOUISA: SAUSAGE! LOVE LOVE. <3 style="font-weight: bold;">Reply: Hey babe. (:

SHERLYN: HELLO FENG YI ! (: LOVES <33 style="font-weight: bold;">Reply: Hello junior! :D

huda: HELLO ! :D
Reply: Hello! Kinda surprised that you'd tag me. Haha. =/

eileen: hellos bus 63 senior :D
Reply: Hello Bus 63 junior. (: Now I don't take Bus 63 le, change to Bus 21 liao. So must call me Bus 21 senior. HAHAHA. (:

Yekliang: heys liked u up le! all better so not to worry...
Yekliang: paisae.... typo... Linked*... haha...
Yekliang: best of luck for Os!
Reply: Hello! Thanks. (:

jUnz-_<™: weeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee..
Reply: Eh don't so random come my blog and "wee" me lei. Haha. But on the contrary, glad that you've tagged me. Thanks. And meetup soon! :)

leimen: HAHA! :D
Reply: You also another random one. Come my blog "HAHA" me. Haha. :)

Byebyebyebyebye! :D

I miss you.
I really missed you a lot.

Call it telepathy,

2009-09-11T01:09:00.003+08:00

All these describe my mood, my emotions now.
Sorry random post.

Change back to what it was.

2009-09-03T18:29:00.003+08:00

It's funny how day by day nothing changes,
but after awhile when you look back,
everything is different.

Hiiiiiiiiiiiiiiii.

Sorry bloggie, didn't really update you that frequently. I promise I'll update you as often as I can, cross my heart. LOL I can't believe that I'm talking and promising to a non-living thing. LOLOLOLOLOL. Lame. ._.

Alright, Prelim is officially O.V.E.R! Should I be happy about it? Yes I should! :D Okay, this marks the beginning of my (little) freedom. 1 day + weekend + 1 week of holidays! Omg, life can't be better than this. (: I'm over the moon and the sun and the whole universe. HAHAHA whatever. :)

Oh ya while I was walking home today, got this bengz screaming and shouting like hell in the middle of the road. Cannot blame him lah, he bengbengz lei. LOL. I'm random one lo, this type of thing also want to blog about. zzz. ._.

Nothing better to do. I'm still in exam mood okay! No joke. Intend to chiong my A-maths and POA during the hols, I can one la lei hor! Believe in me okayyyyyyy. Heh heh heh. :P

Omg I miss Dylan I miss Dylan I miss Dylan like super much please. I wanna meet himmmmmm! )x

Okay la nothing much to post about alr wait for my next post which I think is up next week or next next week haha just kidding okay la really gotta go liao don't miss me okay but I know you will hehehe byebye fullstop.

Okay really gtg alr byez.

Never again.

2009-08-31T22:36:00.002+08:00

I DON'T WANT TO CARE ANYMORE!

I miss you, I need you.
But where were you?

Lust, temptation.

2009-08-29T20:12:00.003+08:00

She finally gave up.
She dropped the fake smile,
as tears ran down her cheek.
She whispered to herself,
"I can't do this anymore."

11 papers were down, 4 more papers to go. Was feeling stressed, perhaps due to the Prelim. Well, I must say that I didn't really study much for it, but at least I had studied a quality sum of it. So I hope that the results aren't too bad, except for A-Maths. HAHAHA. Must really pull my socks for it alr. I'm aiming to get a A(2) for it! Heh, wish my good luck man. :P

Just realised that I'd not upload any picture nowadays. Are you quite bored with my blog? Hmm. Sorry yea, didn't really take any photo nowadays. Shall take some and upload them some times later. ^^

Oh ya, I just made my own skin. Is it nice? Hmm, I think I shall change it soon. =/

junlin: walao, you stead with my girlfriend. LOL! goodnight!
junlin: heyo regular tagger (: all the best for your prelims! ;D
Reply: Hello hello my regular tagger. (: I thought you stead with my boyf! Haha. Nice studying with you for 2 days. Thanks, all the best for your prelim too! Takecare! :D

Jiajie: Wa! B3 for Olevel Chinese huh? Not bad wad. better than me =/
Reply: Hah ya I consider it not bad alr. But I'm greedy, heh. Plus the school want those B3s and below to re-take the papers again which I don't want so ya. Takecare. (:

sha: you missins who??! me ah! hahaha! joking! >.< class="pn_std">sha: ho ho! god luck for maths today! sure you'll see this like afer it. (= im bored of studying always. super stress!! ^_^
Reply: Dong Gua Cha! Haha very long didn't call you this le lei! ^.^ I was quite surprised that you'd tagged me early in the morning at first but just realised that you're fasting. -.- Haha thanks. All the best for the rest of the papers too. Takecare! :D

Jackson: Well, u wouldn't treasure my tags if it would to come everytime mah so i onli tag once in a full moon lor.. TAGGED~ ;)
Jackson: And where got ghost scary meh =.=" i wan watch final destination leh~
Jackson: Tagged~ hehe
Reply: Wah, you also going to become my regular tagger alr ah? Keep on tagging. Heh, continue to tag more ah! Hehe. Final Destination M18 sia, too bad. ):

RIN :): HEY! :D " Who touch my butt?! "
Reply: Hello! Surprised that you'll tag me. Haha! "I think I touch your butt."=O Haha.

I miss you!

Tragedy.

2009-08-29T16:03:00.002+08:00

It happened, again.
History repeated itself.

Shucks.

That's what you get.

2009-08-22T23:23:00.002+08:00

HAPPY BIRTHDAY SIST + JAMUEL! :D

Went out with Jackson to Iluma today, caught Where Got Ghosts. (: Not very funny, some parts were scary too. >.< Asshole Jackson, kept scaring me. ): Haha. Then went home.

Kanna ps-ed by a lot of people - You him her they.

Very tired now, but I have to study. 4 more days to first official Prelim papers. Sigh, don't feel like taking it lo. My Science aren't that good, neither my Combined Humans A Maths and POA. Ah, I need help. Can I still be saved at the eleventh hour? ):

Maybe come to the worse I'll just retain for another year. I'm prepared for it alr.

LOUISA: HEY SAUSAGE. <3 MUACKS.
Reply: Hey Sausage! Loveya! <3

Yong Sheng: Hellos. Link me. thanks
Reply: Hihi! Created a new blog le huh. Haha, linked. (: Takecare, meet up soon ah! ^^

Peiyi,: Hello siaozhabo! Goodluck for whatever exams you're about to take, and my sem tests too! :)
Reply: Hey sist! Thanks a lot. Good luck to your exam too. (:

junlin: haha. you're the best! must tag arh. i'll try to be a better regular tagger (:
junlin: woots. hey my regular tagger (: not my toy. it's aqilah's. i don't eat kinderjoy. hahaha. ;D
junlin: woots. jiayou for prelims! B3 is ok one. i got B4, must go for chinese lesson. sian. haha (:
Reply: Hey regular tagger you're the best man! I'll try to tag you frequently alright! :D Haha, but still must re-take lo. ):

♥ , AMANDA: hello S E N I O R ! <3
Reply: Haha hello! Why you private your blog? Didn't invite me! @#$%^&*! :D

Chiawei: Cheerup la(:
Reply: Hello! Thanks! :D

Vanessa: Hello! I'm here to tag you again. You better love me more i tell you! :P Hey, tell you something, i know someone that looks exactly like you & that person love Dylan hell lots. Even her phone is flooded with Dylan photos. Who ah? :P Heehee, i sound so retarded but who cares?! Meet up soon yeah?
Reply: Hello Butt-butt! Eh now then you mention it I just realised that this person very the familiar lei. Why does it sounds like me? Hahaha. Meet up soon okay! :D

Jackson: tagtagtagtagtagtagtagatag!
Reply: Hello! Finally, your once-in-a-full-moon tag. LOL. :D

sha: hi hi fengyi ! im finally blogging after two weeks of study study! >.<
Reply: Sha! You finally tagged me! Haha. Yea I'd read your blog and tagged you! :D

Hey, I miss you real badly now.
I need you by my side. ):

Dreaming out loud.

2009-08-21T22:45:00.001+08:00

It's true!

The GCE O Level Chinese Examination results came out on Wednesday. My results? A B3. Very disappointed with myself coz I thought that I would get at least an A2 for it. Sigh, cannot be undone now. So I guess I'll have to re-take it. But I don't want! I don't want to re-take! Hur, ):

Prelim is nearing, in 4 more days. To me they're then the official exams. I must really study hard now coz if I do very well for prelim, it means that I'll excel myself for O Level. Jiayou Fengyi, you can do it. (:

Stressed? I am.

Baby, I'm your superstar.
Worship and adore me please. (:

The truth beneath us.

2009-08-16T14:47:00.002+08:00

Been thinking a lot these few days, oh well. (:

Yesterday,
Went out with my Butt-butt/ All-time Favourite Junior, Vanessa! to study at Changi Airport. :D We're like some crazy peepo, laughing and crapping like mad! Updated each other a lot, missed taking bus 63 with her after Choir lah. Went around and around and around the Changi Airport to study and eventually settled down in T1 Kopitiam! Haha. Thought we're the only weirdos who went to food court and study but turned out that there were a hell lots of people alr studying at there! We were like =O when we saw it. Then I taught her POA, call me Miss Chew please. Hehehe. :P Then I did a note for Chemistry and now I still can remember okay! Own notes is the best. My friends, when can we go and study together again? Hahaha.

Today,
Boring Sunday. Had been rotting at home for almost half of the day. Should I go and study? I've not had a proper relaxing day ever since the Block Tests. Sigh. ):

Omg, it's high time to reply the tags. Like tons of it man! :O

pUaysee: gurl..wadd happen worr?!? cheer up alriite?!? ily,,nnn jiayou fer tmr bahhs..tc ..
Reply: Hey girl. (: Everything's fine le. Thanks for the past few days, me love you many many la! ^^ Jiayou for the Oral on Tuesday/ Wednesday? okay! Takecare. :D

junlin: WOAH, YOUR TAGBOARD IS BACK. I JUST REALISED. WAHAHAHA.
junlin: regular tag tag tag. (: how're you? hahaha.
junlin: not bad lah. block test over. whew.
junlin: haha, i see. good luck for your other tests! (:
junlin: aiya, she anyhow one lah. the marks she give arh, tear out from your piece of paper. collect one whole stack then burn.
junlin: heyhey (: you're the BEST! :D
junlin: yoz, regular tagger! how's life? ;D
Reply: Hellooooo my regular tagger! :D You've not been a good regular tagger recently, didn't tag me that often alr. Actually I also. Haha! :P I'm fine, maybe a bit stress now. You? Tag me often okay! Will tag you back soon. Takecare, you're the best! :D

Vanessa: Hello Butt! Came to tag you yo! Anyway, don't so sad or stress lah, must very fun fun fun!! :D & I miss you ):
Vanessa: Hello Buttttttttttttttt! :D Good to see you on friday! <3
Vanessa: Heyhey! Dylan looks familiar, he got twin brother is it? :O
Vanessa: Hello Crazy-over-Dylan Fengyi! ^^ Haha. I'm here to tag you! You better be happy okay! It's a must alright? At least put on a smile when you see me, so at least i know you're alright. If you in school v bored, esp during POA(!!) periods, you can msg me, i'm more than happy to reply (: Kays, last thing, I LOVE YOU! ^^ From: I-think-zac-is-hotter Vanessa (:
Reply: Hello Butt-butt! Whoa, I didn't know you've tagged me so much. =O Haha. I'm very (x100) bored in school ah, so I'll message you. And you must reply me also okay! Sorry if I suddenly go mia coz I'll forget to reply back de! =/ Takecare Butt-butt, nice studying with you yesterday. (:

JUNE(:: FENGYI! TAGGED(: LINK AND TAGG MEEEEEEEEEEEEEEEEEEEE
Reply: Linked and tagged. (:

Jia: hehe :D ! ! !
Jia: ah feng ;P .. !!! Hello :D ... tagged <3
Jia: hello :) ... Tagged <3
Reply: Hello Ah Jia! :D

enci: Hey!!!! What's up these days?
enci: awesome to hear from youuuuu!!!! MISS CHOIR. MISS SEC SCH. MISS DHARMA CLASS OF SLEEPING!!
Reply: Hi! Haha, then you must come back to see MJR as often as you can! :D

Kimberly: Hello FENGYIIIIIIIIIiII! :D Haha, luv chusxz.. LOL!
Kimberly: Fengyi, I love you :D
Kimberly: FENGYI! :) I miss you so muchhhhhhh.. See you soon and tag me more stingy aunty-to-be :)
Reply: Kimberlyyyyy! I miss you so much, though I saw you on Friday. LOL! I'll tag or maybe spam you okay, me love you lots! :D

Peiyi,: In conclusion, your post date 31 July is to tell people BE HAPPY! Hello sucker! :)
Reply: Haha ya lah! Hello bitch! :D

Chiawei: TAGGED:D
Chiawei: tagged;D
Reply: Hello! :D

SHERLYn: HELLO FENG YI !! ;D LOVES !! <33
SHERLYN: HEYA FENG YI !! ;D LOVES !! <3333
Reply: Hellooooo junior! :D

Jackson: Tagg~ ;)
Jackson: heyhey :) :)
Reply: Hello! Cheer up okay! (:

HzH: talk to me on msn today... (saturday)
Reply: Hi. (:

jUnz-_<™: Hey yo! So when are we meeting up again?
Reply: YOYOZ! Anytime after my prelim? Actually anytime also can, but must accomodate with the others. You organise can? Since your prelim is over. Haha. :P

shawn: don't worry la! still got me what!!!!hahaha don't sad
Reply: Haha thanks. (:

wei lin (3: dun b;ame urself too much lahhs. sumtimes frens choose to go their own way is their own chice. it has nth to do with others. be urself. be the fengyi we all love.
Reply: Hey, thanks a lot. I'm fine la, thanks. (:

Give me a lesson on how to steal a heart as fast as you stole mine.
I miss you!

Misunderstanding.

2009-08-11T14:59:00.002+08:00

Yes it's been a misunderstanding.

I don't know if it's too late to say now, but Sha and I didn't quarrel. Nope we didn't. The previous previous post was talking about something else. And the "Yes Sha, you're right." was talking about the things that Sha has told me when we were going home that day. And I've been thinking a lot and I think that I'm a troublemaker, not SHE said I am the troublemaker or what. NO OKAY!

And btw, whoever that asked Sha, please don't make any assumption. Okay I don't know whether you had made any assumption or not and this may offend you but I don't care. If you want to ask, please ask me directly. Don't ask others, thanks a lot. (: And you just read and shut up. Do me this favour please.

And once again, we didn't quarrel and I didn't quarrel with anyone at all.

I don't know what to do alr. It's like, everything I had written in my blog it would cause misunderstandings. Surely one. What, curse is it? Wtf is this? If my blogging cause so much problems, then I should close this blog.

It will never be the same again.

2009-08-09T14:13:00.004+08:00

HAPPY BIRTHDAY SINGAPORE!

Proud to be a Singaporean. (:

My house's desktop is down. Officially. That means I'll have difficulties to blog, to facebook, to twitter, to chat with friends online, and to fight against my siblings for this laptop. zzz, I'm so wanna have a new desktop right now!

Anyway, Oral was a fucked up one. I don't know what happened to me that day, just couldn't function well. My brain hurt like fuck and when I see Mr. Tan's face I just stared blank. Wtf, I failed. Ah whatever, so not wanting to take any exam now. zzz.

I want to drop out of school, seriously I want.

I can't change anything. The cruel fact is that this is reality. So, I guess we've to move on. You're happy with your clique and I'm happy to hear that. At least everyone isn't feeling miserable. Just wish that we can still go out as a clique again someday. At least for once.

Friendship, kinship, goodbye.

I'm bored right now, anyone wants to go out with me today or tomorrow?

Pretty please?

I hope it's just a dream.

2009-08-08T14:31:00.003+08:00

Nobody is perfect, I shouldn't pick on you.
If not, things wouldn't turn out this way.
I'm sorry.

I find blogging very meaningless now.

It's about me all along.

2009-08-07T22:27:00.004+08:00

Can you see the real me?

Everyday, I'll bring a fake smile and tried to be hyper and happy in school so that people around me can be happy the whole day. But it didn't work. In fact, I'm just a nuisance of everything.

Yes Sha, you're right. I am the troublemaker. I brought nothing but conflicts between us. Where has the six of us gone to? Do you still remember the six of us used to go out together? If you're sad, then I'm depressed! If it weren't me, things wouldn't turn out this way. If it weren't me, maybe the six of us would still be together. I want to rewind back again, to where we would always chitchat together. But now? You have your own clique, same to me. But this wasn't what I want. I want us to be back together again.

Maybe people do changed, maybe I'm just that fucking bitch who breakup other people's friendship. Yes I'm a bitch. I'm selfish and inconsiderate, don't give a fuck care for others. I like it when everyone is together, hate it when my friends go out with other friends. I'm an asshole, a stupid bitch or whatever you want to call. Hell, just fuck off from my life. I don't want to care anymore. My studies sucks, friends don't trust each other anymore and just go their fucking own separate ways as and when they like, parents just a total shit fuck. I might as well quit school and forgo that fucking O Level or better, just end my life.

And people, don't bother to tell me anything anymore. I'm such a failure, I cannot do anything to help others. What can I do? Sit there and listen only. I felt so useless everytime people ask me how or very sad and yet I couldn't do anything to help them or at least cheer them up. Fuck la, why must everything happened together at the same time!!!!!!!!!!

Oh fuck, I don't know what to do now. Can someone tell me?

FUCK OFF FROM MY LIFE AND DON'T BOTHER TO TALK TO ME!

Oh shit, I feel like crying now!

I found you.

2009-08-05T23:22:00.004+08:00

He's fucking hot! He has gorgeous eyes. Ahhh! :D

Nothing much to update, just that Cheryl asked me to. :D
So tada, CHERYL I UPDATED LIAO. (:

And I want to thanks those who had given me plenty of smiles from the past till now, be it those I'm with or not now. Thanks a lot, for bringing me up to where I am. I just hope that everyone will be happy and be together. Cheryl, Eunice and Yingying, I really missed those times where the five or six of us would always go out and eat and study. Can we go out again?

P/s: JUNLIN IS THE BEST! :D

What a sore loser. (:

Don't pretend that you don't know,
I know you know.

You're my world.

2009-08-02T12:21:00.003+08:00

And tell me now,
how do I live without you?
I want to know,
how do I breathe without you?
If you ever go,
how do I ever, ever survive?
How do I, how do I,
oh how do I live?

There'd be no world left.

Thinking of you.

2009-07-31T20:49:00.002+08:00

Cinderella will never get a good ending.

Happy people: Continue to be happy everyday!
Sad people: Cheer up! There are millions of reasons why you should be happy, and just be happy for the sake of happy. Smile and everything will be alright. (:
Angry people: Why bother to get angry over something that was over? Be happy!

Goodbye, (:

Lost.

2009-07-26T20:11:00.005+08:00

HAPPY BIRTHDAY LEVON!

Sorry Junting and Yongsheng that I didn't go out studying with you guys yesterday and today. Not I cannot go, is I don't feel like going out. I'm super sorry. ): Promise you guys that I'll go and study next weekends. (:

Been nua-ing at home for the 2 days, lazy to walk around and do stuffs but I have to. zzz. Anyway, managed to finish studying SS which is a good thing and now I'm going to start revising my Chemistry. And hell, I've forgotten to do the A-maths booklet which I'm so dead now coz there's a hell lots of topics that I have not do yet.
Die, x.x

Am happy that I'd spent my quality time with my friends, be it studying or eating or going out. (: Nice studying with Puaysee Sha and Cheryl for the past few days but more friends would be better I guess. LOL, I wonder who I'm referring to. Hmm... xD

Seriously, I don't know what I'm doing anymore. I do this do that also not right, just what am I doing!!! Feeling super down after listening to a song which reminded me of something. Hais... I promised myself not to do this anymore but I don't know I can still continue to maintain like this or not, judging by the current situation. I don't care anymore, I'm very tired alr. Thanks everyone who tried to help me, I appreciate that. But ya, I really don't want to be bothered by it alr. Lost everything, but I don't want to lost myself. ):

I need to talk to someone, anyone.
Maybe Sha or Puaysee or both of them.
D:

I miss you! )':

To live and let die.

2009-07-25T23:42:00.002+08:00

Yoz, (:

Yesterday was fun, with Sha the whole day! :D Early in the morning nice things started to happen on Sha, and I kept disiao-ing her with that hehehe. :P Lessons were okay, until the last English lesson as I started to feel damn emotional. Sigh... Skipped POA and heard from Shuqi that TAH super angry, but who cares? :D The guys ps-ed Sha and me so we decided to go Plaza Sing and watch Harry Potter And The Half-Blood Prince! :D Omg Sha showed me a guitar that was fucking nice and it's only $1600! Omg omg omg I'm so gonna touch it should anyone buys it. ^^ And Harry Potter was nice and I rate it 3.5/ 5. (:

Walao I jealous lei! Got one guy tapped Sha's shoulder and he's fucking hot! His eyes were damn georgous can! Like damn angmoh one lo but he looked like he's a Singaporean. Walao not fair! Why I so stupid go stood in front of Sha. >:D Haha nevermind, I just want ____________. (:

Had a longgggggggg walk with her and I confided to her. (: Thanks Sha for accompanying me yesterday and hope that everything will go smoothly on Monday for you, :D

Byebye, it's going to be Midnight soon.
I want go do revision le!

Give me a hint.

2009-07-20T23:57:00.001+08:00

Life's great.

How I wish Life is just like a game, where there will always be another try when you're dead.
Oooh, I want. (:

My last mistake.

2009-07-19T12:34:00.001+08:00

Hi! :D

My head is feeling kinda heavy now, I'm sick? Haha. I have the urge of not going to school tomorrow but I know I can't coz I've alr promised Sha to do a series of things after school. Hehe. ^^

Jamming with Sha was fun! First time and I enjoyed a lot. (: Must go jam frequently with her alr. Haha. Stayed overnight at Cheryl's house was great too. With Eunice. (: First time also. Haha.

Going to study with Junting Yongsheng + Kaihui later, had been studying over the past 3 days or say, the whole 1 week. But I like! Shall overnight often. Hehehe. :P

Short update, though lots of things happened recently. Aiya, stm la. I need raisins + blueberries! ):

CHERYL SHA AND PUAYSEE UPDATE! :D

And I can't think of anybody else
Who I hate to miss as much as I hate missing you.

Amends.

2009-07-08T21:10:00.002+08:00

聴

Nice word, I like the original words more than the simplified ones. At least they provides a more meaningful meaning. Like this word 聴, (from Mdm Cheah) it means use your ear to listen, give 100% full attention, eyes always concentrate on one thing/ person, and give your heart to the thing/ person. But the simplified 听, it means you talk more than you listen, which is no good. LOL. I think it's somehow means like that.

Okayyyyy. Life's great + wonderful = I LOVE IT! :D Because my life revolves around with great and crazy peeps - Cheryl Eunice Puaysee Sha and Yingying. I'm grateful that my mom actually sent me to this school. If I'm not here, I won't experience and learnt from many things that happened in my 4 years life. If I'm not here, I won't know my crazy friends and perhaps I'll still be an introvert la. Okay, I'm still am now but not as serious as 3 years back hor!

Heh heh heh, me so happy now. Me is a happy girl. :D

Okay actually not but I'm telling myself now and then that I'll think of him so often now but... Okay Puaysee you win liao. ): I cannot. Sigh, anyone can use a hammer or bat to hit my head so I'll suffer from concussion and forget the past? Wait no! I don't want to forget my friends!
Forget it.

Oh ya, sometimes I feel that I'm a failure. I failed to be a good daughter in my dad's eyes cos it's either his expectation is too high or I'm giving myself too much stress alr. It seems that I always couldn't do a simple shit right. I wanna be a successful woman in the near future, but I doubt so now.

I failed to be a good student in some teachers' eyes too. I slept in class and not concentrated enough. I can see disappointment in their eyes. I don't want it too, you think I like it? But I can't help it. School hours are long and everytime I go home it's alr late in the afternoon or maybe evening time alr. Then I still need to bathe eat what shit lei. Even if I minus away watching tv time and going out with friends, I'll not have the time to do finish a day's works. Teachers are so selfish, they keep throwing homework to us as though we're attending their own subject only. zzz, can't they be more considerate?

I failed to be a good friend too. I feel that I can never communicate well with my friends, maybe I'm just too introvert alr. I want to crap with them too, but when it comes to only my friend and I, I'll tend to be damn quiet. I don't know what's wrong with me, maybe that's why I'm a weird person. Maybe I should learn how to be an extrovert, be more sociable and guailan with people. :D

I WANT TO BE A BETTER PERSON AND I BELIEVE I CAN DO IT!
You must help me through too. (:

I need my subconscious mind now. It tells me everything I need to do. Oh motivation. (:

SHA UPDATE! :D

I'm missing you, right here.
But you'll never realise.

Dirty little secret.

2009-07-02T21:40:00.004+08:00

Vanessa Butt loves her Butt-Butt many many! <3

Vanessa forced me to write one. So bhb, hehe. :P
Just kidding, I love her to the max okaysxz! :D

Fuck, I'm so damn sad now!
But thanks Sha for being my listening ear, :)

Am I a weird person?
I find myself one weird person lei. Coz I don't communicate with others sometimes, and even if I do, I'll have nothing to talk about. I'm not like my friends, where they have tons and tons of common topics to talk about. If I'm in a group of people, I'll be the only one whose damn quiet. But I don't mind, really I don't mind. Coz at least I still can listen to what they'll say and laugh with them. But sometimes I'll feel that I'm being left out but I know is I myself who make myself damn pathetic. I tried to be sociable but couldn't. Something stopped me. I don't know what's wrong with me. I can't do a single shit right. I always screw things up, screw people up, screw my life up.

Stupid! I missed the chance of talking to him just now. Fuck me man, stupid! Sigh, now I'd regretted. But what's the point of crying over a spilled milk? Fucking useless me. I know he's talking to me but I just couldn't face him. I couldn't overcome myself. I've no confidence in myself. I lack of courage, lack of confidence, lack of everything. I wanted to tell him my thinkings, my feelings so much. But when I come face to face with him, I just become a stupid wall. Don't dare to talk and face him. I wanted to, but I lacked of courage. Just what the fuck am I thinking!

I guess I'm just a failure for my whole life.

Ah, 'O' 水准华文口试会考 is tomorrow! Shit, I haven't like try practicing la. zzz, tomorrow comfirm die one. x.x
Wish me luck kk. (:

Heh Sha, guess what I'm feeling now?
:D (: ): )': D: -.- >.< ^^

我们真的结束了吗?

Last night on Earth.

2009-06-28T20:19:00.004+08:00

NOT GOING TO BLOG ABOUT ANYTHING
UNTIL OLEVELS ARE OFFICIALLY OVER.
Hopefully.

Haha, maybe once in a month I'll update bah. Or something to rant/ talk about. (:

Before I go off, just a quick update. (:

After today, don't think I'll go out that often alr. BECAUSE OLEVELS IS JUST AROUND THE CORNER, LIKE IN 3 MORE MONTHS? MY GOD, AND I HAVEN'T REALLY THAT PREPARED TO TAKE THE PRELIM YET, NOT TO SAY OLEVEL UH.
GOD, PLEASE BLESS ME. ):

But but but but but! If you want to jio me out (hehehe :P), I still can. Hehe. Coz everytime stay at home study will also kisiao one mah, correct?! So must relax relax, go eat or what. Hahaha. :B

Oh, I wanna go Soeul Garden. Sha! Let's go someday, with Cha Family. Haha. ^^ And I also want to save $$$ to buy clothes + shoes + FOOD! + a lot a lot a lot. Hehehe. I can imagine how many things I can buy alr when December comes. :P Omg can't wait! :D

Okay la, nothing to update alr. So I guess, this is it?
Fyi, tagboard removed.

Kk, byebye.
MISS ME! :P

You're my chocolate.

2009-06-26T16:57:00.003+08:00

Shit, the online quiz for Chemistry is no more available. I haven't do the quiz yet.
Fuck!

Damn it, yesterday I still reminded myself that I must do but in the end went to sleep. zzz. -.- Shit la, Miss Selina is so going to kill me lo. Ah whatever.

Yesterday,
Went out with secondary school friends to watch Transformers again! Woohoo, I can't get enough of that movie. It's just so awesome alright! You must watch it. Gogogo! :D

Met up with Puaysee and Eunice first to eat. Then Yingying came then went to find Lynn and Kaitat. Then the rest came. Supposed to watch the movie at Plaza Sing but all were booked le so we headed down to Tiong Bahru to watch. Crapped a lot with Sha during the movie. Kept on laughing and disiao-ing the people. Haha. Then went to KLP with Sha Cheryl Eunice Zewei Zeyuan Raymond Edwin and Guowei as the guys went to ECP. Ate and watched them played arcade for a while more before going home. Had a nice talking session with Sha before home-d.

Nice day with them, and I wanna watch Transformers again again again! :D

Zeyuan so cute! :B

Today,
Asshole, the quiz really no more le la. Fuck man, I can imagine what Miss Selina will tell me when school reopens. Oh no, ):

Sha,
I think I need your advice.

BUMBLEBEE!

2009-06-24T21:12:00.003+08:00

Quick post:

I WANT TO POST!!! :D
Went out with primary school friends, watched TRANSFORMERS 2! It's super duper nice okay! It's a must-watch movie! :D Anyway tomorrow I'm going to watch again. Hehehe. :P

Went around slacking coz seriously bored like hell HAHAHA. Went to eat at KFC then train from Tampines to Pasir Ris then to Eunos. Then went to Ubi and slacked. Went into the new Maha Bodhi and oh my, it's really damn big and nice. Nowadays de Maha Bodhian are far more luckier and have more privileges than my times. They're like going to condo and study okay! Okay exaggerating but there's some parts that really look like condo. zzz. Walao, not fair. ):

Hah, tomorrow going to watch Transformers 2 again.
Ohmygod, how happy can I be?

Will be seeing (: tomorrow. Omg can't wait! :D

Okay byebye.

Far away from the memories.

2009-06-23T17:16:00.006+08:00

Hi.

This might be the last post of my blog. Might. Have no inspiration to blog anymore, perhaps someday later I'll just delete this blog away until 'O's are over.
Miss me? :D

Anyway, supposed to go out with Shawn today but he's still sleeping now I think? At this hour of time. Haha. Then I think not going out liao. Tried doing Maths booklet but failed. x.x Sat there for like 5 mins only my butt itchy liao. Distracted. zzz. Cannot make it one sia me. I seriously need motivation + focus now. )x

So now I'm bored. Hell yes. But I'll not let you get bored. I know my post is a bit wordy so yea, pictures!

I love the pictures a lot! It's so, photography. And if I have a nice camera I wanna travel around the world to capture the most beautiful moments ever. (:

I've learnt to let go,
let go of the things that doesn't belong to me.
Don't intend to clinging on them anymore,
and never ever try to wanting them back again.
Because I've learnt to, let go.

So, have you enjoyed yourself today?

Time will end everything.

2009-06-21T17:01:00.004+08:00

HAPPY FATHER'S DAY!
Dad I love you, though sometimes I hate the teaching you implied on me.

HAPPY BIRTHDAY SUKI!
One more month and you're 2 years old. (:

Hihi! :D

Sorry uh, had neglected my blog. )x Just watched finish 霹雳 MIT!
One word: NICE! xD

Used 5 days to chiong finish 2 shows, 翻滚吧！蛋炒饭 and 霹雳 MIT. All were wonderful shows, too bad Singapore couldn't produce this type of good shows. ): Hmm, I think I shall go watch 终级三国 after OLEVEL? Haha, it seems so nice lei. But then I haven't even watch finish 终级一家 yet lei... Aiya, maybe I shall start watching over again. From 终级一班 to 终级一家 to 终级三国! HAHAHA. Y(^^)Y

Shit man, I haven't finish the hols homework yet. And hols are going to be over soon. Ah, shall start doing homework now. Shall burn midnight oil to chiong chiong chiong chiong chiong all the homework! Yay! :D Now my priority is study. Focus!

Currently thinking of: Jiro, Danson, Fabien, Arron, Xiaogui and Guigui. 霹雳 MIT, 终级一班终级一家终级三国, hols homework, bitch(es), motivation.

Btw I'm not going to Plurk anymore. And soon I'll delete away my tagboard. And after hols hopefully I'll not update my blog after OLEVEL bah. Maybe I soon delete away my blog? x.x

Miss me!

Don't let your heart go.

2009-06-17T23:34:00.002+08:00

HAPPY BIRTHDAY PAKTENG! :D :D :D

Woohoo, didn't do any homework at all today! Felt, great? LOL. Did some housework then off to watch my 翻滚吧！蛋炒饭. Woohoo, it's been a long long long long long time since I had last watched it man. Aye, now the show is getting more and more interesting le. Shall chiong it before school reopens! :D

Walao now I is bored de lo. Extremely can! )x
You've onlined but I don't dare to talk to you, WHY!!! D:
Someone helps and saves me please.

Run back to the past.

2009-06-16T22:11:00.002+08:00

Ding dong!

Me is so happy now I don't know why. Hehehe. Maybe because me got do homework today, GUAIKIA RIGHT! :D :D :D Hehe.

Okay, enough of being _______ liao. (: Tried to revise but obviously, cannot. -.- But I did my homework. Hmmmmmmm, maybe later I should go and study again? Okay now (time check) it's 10.13pm le. Should I, should I not? x.x

Today supposed to go out one lor. My dog made me so fucked up, threw my tamtrum and didn't go liao. zzz. Should have learn how to control my emotions.
WINNERS CONTROL EMOTIONS; LOSERS LET EMOTIONS CONTROL THEM.
I'm the latter, damn it. x.x

Whatever. I'm just so dying to go out now. I think because last week I kept going out then now I'm addicted in going out le? LOL. And super powerful sia last week. Forgot which day liao but I went out with Eunice with $2.30 only lo. But I still survived the whole day lei. Powerful.

Wah piang I really is bored de lo. Jackson haven't online yet, cannot entertain me HAHAHA. You didn't online, cannot talk to you. ))))': He haven't reply me yet, sianz. ):

Wah my sis just changed blogskin lei, should I change also har? o.o?

TO SHA:
GIRL I MISS YOU A LOT A LOT LEI! FASTER COME BACK OKAY! I'VE GOTTEN YOUR CHARCOAL CUP, SHALL PASS TO YOU WHEN SCHOOL REOPENS. :D

TO EUNICE, PUAYSEE, CHERYL, LYNN:
HEY, I MISS YOU GUYS. LET'S GO WATCH DRAG ME TO HELL OKAY! :D

Very hungry now.
Me want fastfood!
Mcdonald! :D